KIAA0827

Product ID	ORK01608
Accession No	AB020634
Description	nuclear factor of activated T-cells 5, tonicity-responsive, transcript variant 3
Clone name	hh03726
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6019 bp) Predicted protein sequence (1608 aa)
HaloTag ORF Clone	FHC01608
Flexi ORF Clone	FXC01608
Source	Human adult brain
Rouge ID	mKIAA0827 by Kazusa Mouse cDNA Project

Length: 6019 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1105 bp
Genome contig ID	gi51511732f_68057388
PolyA signal sequence (TATAAA,-10)	+--------+--------+----*----+---- AATTTTTCCCTCTAATAGGAAACAGTATAAATTTT
Flanking genome sequence (231474 - 231523)	----+--------+--------+--------+--------+----* AATTAAAAAAAAAAGGCAAACTAAAATTTCTTGAAATATCACTTCTCCCT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	16	f	68157388	68288860	14	100.0	Perfect prediction

Length: 1608 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001093880	99.1	similar to nucl...	Macaca mulatta
O94916	100.0	Nuclear factor ...	Homo sapiens
XP_001168930	97.1	nuclear factor ...	Pan troglodytes
NP_619727	98.8	nuclear factor ...	Homo sapiens
AAI31510	98.8	NFAT5 protein [...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB028971	0.00056	26.9	KIAA1048

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR008366	384	400	PR01789	Nuclear factor of activated T cells (NFAT)
	IPR008366	502	524	PR01789	Nuclear factor of activated T cells (NFAT)
	IPR008366	543	562	PR01789	Nuclear factor of activated T cells (NFAT)
	IPR008366	601	620	PR01789	Nuclear factor of activated T cells (NFAT)
HMMPfam	IPR011539	359	516	PF00554	Rel homology
HMMPfam	IPR002909	522	618	PF01833	Cell surface receptor IPT/TIG
HMMSmart	IPR002909	521	619	SM00429	Cell surface receptor IPT/TIG
ProfileScan	IPR011539	341	520	PS50254	Rel homology

Primer_f	TTGGAGAAACTGAAGGGTAAC
Primer_r	GAAACCCAGAGAACTAACAAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TTGGAGAAACTGAAGGGTAAC
Primer_r	GAAACCCAGAGAACTAACAAC
PCR product length	161 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles