Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK00135 |
---|---|
Accession No | AB020637 |
Description | endonuclease domain containing 1 |
Clone name | hj04436 |
Vector information | |
cDNA sequence | DNA sequence (4638 bp) Predicted protein sequence (523 aa) |
HaloTag ORF Clone |
FHC00135
|
Flexi ORF Clone | FXC00135 |
Source | Human adult brain |
Rouge ID |
mKIAA0830
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 3066 bp |
---|---|
Genome contig ID | gi51511727f_94362671 |
PolyA signal sequence (AATAAA,-18) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (142786 - 142835) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 11 | f | 94462671 | 94505455 | 2 | 99.1 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001604 | 84 | 289 | PF01223 | DNA/RNA non-specific endonuclease |
HMMSmart | IPR001604 | 85 | 290 | SM00477 | DNA/RNA non-specific endonuclease |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 23 | AMGTARWLALGSLFALAGLLEGR | 45 | SECONDARY | 23 | 2 | 235 | KVAVPEFVWLAACCAVPGGGWAM | 257 | PRIMARY | 23 | 3 | 373 | VVAILKNIVYFLWCVTKQVINGI | 395 | PRIMARY | 23 | 4 | 424 | VLKVVAKVIRALLRILCCLLKAI | 446 | PRIMARY | 23 | 5 | 479 | ALGLGGTVSLLFDTAFGTLGGLF | 501 | SECONDARY | 23 |
---|
RT-PCR-ELISA |
Primer_f | CCTGTTCCTAATGAGCTACGC |
---|---|
Primer_r | GGTTCACTTTGGTTCCTCCTC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | UniGene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |