KIAA0833

Product ID	ORK00650
Accession No	AB020640
Description	calmodulin binding transcription activator 1, transcript variant 1
Clone name	hg01719s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6582 bp) Predicted protein sequence (1734 aa)
HaloTag ORF Clone	FHC00650
Flexi ORF Clone	FXC00650
Source	Human adult brain
Rouge ID	mKIAA0833 by Kazusa Mouse cDNA Project
Note	We replaced hj04851 and hg01719, former representative clones for KIAA0833 with hg01719s1. (2001/5/29,2002/5/10)

Length: 6582 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1353 bp
Genome contig ID	gi89161185f_6667971
PolyA signal sequence (ACTAAA,-10)	+--------+--------+----*----+---- TAGGAGAACATTTTGCTAAAGCATGACTAAACTGC
Flanking genome sequence (1082521 - 1082570)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAGAGCTACTGTATTTAGACTTAGGAAAAAAGGCAGAGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	f	6767971	7750490	21	99.5	Internal No-hit

Length: 1734 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9Y6Y1	100.0	Calmodulin-bind...	Homo sapiens
XP_001915249	96.5	calmodulin bind...	Equus caballus
CAM24365	94.0	calmodulin bind...	Mus musculus
A2A891	93.6	Calmodulin-bind...	Mus musculus
EAW71581	100.0	hCG21816, isofo...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020716	8.4e-54	42.3	KIAA0909

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR005559	128	244	PF03859	CG-1
	IPR002909	934	1013	PF01833	Cell surface receptor IPT/TIG
	IPR002110	1125	1147	PF00023	Ankyrin
	IPR002110	1170	1190	PF00023	Ankyrin
	IPR000048	1609	1629	PF00612	IQ calmodulin-binding region
	IPR000048	1632	1652	PF00612	IQ calmodulin-binding region
ProfileScan	IPR002110	1125	1147	PS50088	Ankyrin
	IPR002110	1125	1224	PS50297	Ankyrin
	IPR000048	1631	1657	PS50096	IQ calmodulin-binding region

Primer_f	GCGAGAAAAATGTGGATGTAC
Primer_r	CATTTTACAGACCATAGCCAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GCGAGAAAAATGTGGATGTAC
Primer_r	CATTTTACAGACCATAGCCAC
PCR product length	123 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles