KIAA0875

Product ID	ORK00668
Accession No	AB020682
Description	F-box protein 21, transcript variant 2
Clone name	hk07350
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4168 bp) Predicted protein sequence (621 aa)
HaloTag ORF Clone	FHC00668
Flexi ORF Clone	FXC00668
Source	Human adult brain
Rouge ID	mKIAA0875 by Kazusa Mouse cDNA Project

Length: 4168 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2301 bp
Genome contig ID	gi89161190r_115965974
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- TTGTACAATGATTAATAAATGGAACTTATCCAGAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAACCACGCAAATGGCCTGCCCAATTTCGTTTGAGGACAGAAAGCCCAGC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	12	r	116065974	116112645	12	99.4	Perfect prediction

Length: 621 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAH91496	100.0	FBXO21 protein ...	Homo sapiens
XP_001083109	99.7	similar to F-bo...	Macaca mulatta
Q5R5S1	99.7	F-box only prot...	Pongo abelii
O94952	98.9	F-box only prot...	Homo sapiens
XP_001082993	98.6	similar to F-bo...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	NULL	496	573	PD415267	NULL
HMMPfam	IPR001810	28	77	PF00646	Cyclin-like F-box
HMMPfam	IPR011722	493	593	PF08755	Hemimethylated DNA-binding region
HMMTigr	IPR011722	493	590	TIGR02097	Hemimethylated DNA-binding region

Primer_f	ATGTTGAATGCCTGCTGCTTG
Primer_r	GCTGTGAGTGGTTACGTTTCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GAGCTATTTAATCCACTGTCC
Primer_r	GCTGTGAGTGGTTACGTTTCC
PCR product length	91 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles