Gene/Protein Characteristic Table for KIAA0902
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK04592
Accession No AB020709
Description connector enhancer of kinase suppressor of Ras 2
Clone name hk09777
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4349 bp)
Predicted protein sequence (910 aa)
Source Human adult brain
Rouge ID mKIAA0902 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4349 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning Warning
Integrity of 3' end
Length of 3'UTR 1211 bp
Genome contig ID gi89161218f_21202481
PolyA signal sequence
(AATAAA,-27)
+----*----+----*----+----*----+----
TACTTAAAAATAAAAATATGACCAATTGGTATCAG
Flanking genome sequence
(368294 - 368343)
----+----*----+----*----+----*----+----*----+----*
ATCTTTTCAGATAGCTAAATAATTTGCTAAGTATGCCTGATAGTAAATAT
Features of the protein sequence
Description

Length: 910 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
AAL60503 0 98.7 connector enhan...
Homo sapiens
Q8WXI2 0 98.7 Connector enhan...
Homo sapiens
EAW98976 0 98.7 connector enhan...
Homo sapiens
XP_001086538 0 98.7 similar to conn...
Macaca mulatta
XP_858959 0 98.6 similar to conn...
Canis lupus fam...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB007863 8.3e-19 38.1 KIAA0403
AB051473 3.4e-05 23.9 KIAA1686
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001660 26 90 PF00536 Sterile alpha motif SAM
IPR001478 234 311 PF00595 PDZ/DHR/GLGF
IPR010599 349 532 PF06663 Connector enhancer of kinase suppressor of ras 2
IPR001849 588 686 PF00169 Pleckstrin-like
HMMSmart IPR001660 25 93 SM00454 Sterile alpha motif SAM
IPR001478 242 314 SM00228 PDZ/DHR/GLGF
IPR001849 588 688 SM00233 Pleckstrin-like
ProfileScan IPR001660 28 93 PS50105 Sterile alpha motif SAM
IPR001478 232 314 PS50106 PDZ/DHR/GLGF
IPR001849 587 686 PS50003 Pleckstrin-like
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f AATCTATAGGCTGTGGGTTTC
Primer_r ATTGATTGAGCCATAGGGGAC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 1
Experimental conditions
Panel name GeneBridge 4
Primer_f AATCTATAGGCTGTGGGTTTC
Primer_r ATTGATTGAGCCATAGGGGAC
PCR product length 113 bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp