Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK04592 |
---|---|
Accession No | AB020709 |
Description | connector enhancer of kinase suppressor of Ras 2 |
Clone name | hk09777 |
Vector information | |
cDNA sequence | DNA sequence (4349 bp) Predicted protein sequence (910 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA0902
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | Warning |
Length of 3'UTR | 1211 bp |
---|---|
Genome contig ID | gi89161218f_21202481 |
PolyA signal sequence (AATAAA,-27) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (368294 - 368343) |
----+----*----+----*----+----*----+----*----+----* |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001660 | 26 | 90 | PF00536 | Sterile alpha motif SAM |
IPR001478 | 234 | 311 | PF00595 | PDZ/DHR/GLGF | |
IPR010599 | 349 | 532 | PF06663 | Connector enhancer of kinase suppressor of ras 2 | |
IPR001849 | 588 | 686 | PF00169 | Pleckstrin-like | |
HMMSmart | IPR001660 | 25 | 93 | SM00454 | Sterile alpha motif SAM |
IPR001478 | 242 | 314 | SM00228 | PDZ/DHR/GLGF | |
IPR001849 | 588 | 688 | SM00233 | Pleckstrin-like | |
ProfileScan | IPR001660 | 28 | 93 | PS50105 | Sterile alpha motif SAM |
IPR001478 | 232 | 314 | PS50106 | PDZ/DHR/GLGF | |
IPR001849 | 587 | 686 | PS50003 | Pleckstrin-like |
RT-PCR-ELISA |
Primer_f | AATCTATAGGCTGTGGGTTTC |
---|---|
Primer_r | ATTGATTGAGCCATAGGGGAC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | AATCTATAGGCTGTGGGTTTC |
Primer_r | ATTGATTGAGCCATAGGGGAC |
PCR product length | 113 bp |
PCR conditions | 95 °C15 sec62 °C60 sec30 cycles |