KIAA1686

Product ID	ORK00886
Accession No	AB051473
Description	pleckstrin homology domain containing, family A member 5, transcript variant 2
Clone name	fh25862s1
Vector information	The cDNA fragment was originally inserted at SalI-NotI site ... The cDNA fragment was originally inserted at SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR) and a RT-PCR product (1-1462) was subcloned upstream of the cDNA (1463-6488). The adjacent sequence to the 5' end of the cDNA is as follows: GGGCCCCCCC TCGAGGTCGA CCCACGCGGC CGCGGGAATT CGATT-5' end of cDNA.
cDNA sequence	DNA sequence (6488 bp) Predicted protein sequence (1175 aa)
HaloTag ORF Clone	FHC00886
Flexi ORF Clone	FXC00886
Source	Human fetal brain
Rouge ID	mKIAA1686 by Kazusa Mouse cDNA Project
Note	We replaced fh25862, former representative clones for KIAA1686 with fh25862s1. (2002/5/10)

Length: 6488 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2959 bp
Genome contig ID	gi89161190f_19073997
PolyA signal sequence (None)	+--------+--------+----*----+---- CTCCAGCCTGGGCAACAAGAACGAAACTCTGTCTC
Flanking genome sequence (343874 - 343923)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAATGGTGACTGTTGCTACTGGTGACGTAATAACACAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	12	f	19173997	19417869	28	99.5	Perfect prediction

Length: 1175 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW96392	100.0	pleckstrin homo...	Homo sapiens
EAW96394	90.2	pleckstrin homo...	Homo sapiens
XP_001093182	92.4	similar to plec...	Macaca mulatta
XP_520779	94.2	pleckstrin homo...	Pan troglodytes
BAG58986	88.3	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023186	1.8e-20	31.1	KIAA0969
AB020709	8.1e-05	23.9	KIAA0902
AB007863	0.00043	25.1	KIAA0403

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001202	13	42	PF00397	WW/Rsp5/WWP
	IPR001202	59	88	PF00397	WW/Rsp5/WWP
	IPR001849	171	269	PF00169	Pleckstrin-like
HMMSmart	IPR001202	12	44	SM00456	WW/Rsp5/WWP
	IPR001202	58	90	SM00456	WW/Rsp5/WWP
	IPR001849	171	271	SM00233	Pleckstrin-like
ProfileScan	IPR001202	11	44	PS50020	WW/Rsp5/WWP
	IPR001202	57	90	PS50020	WW/Rsp5/WWP
	IPR001849	170	269	PS50003	Pleckstrin-like
ScanRegExp	IPR001202	17	42	PS01159	WW/Rsp5/WWP

Primer_f	ACAAGATGAAGGTAGAGGCAC
Primer_r	CATTTCTATCTCTTGGCTGGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-