KIAA0910

Product ID	ORK01136
Accession No	AB020717
Description	synaptojanin 1
Clone name	hg02207s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6997 bp) Predicted protein sequence (1315 aa)
HaloTag ORF Clone	FHC01136
Flexi ORF Clone	FXC01136
Source	Human adult brain
Rouge ID	mKIAA0910 by Kazusa Mouse cDNA Project
Note	We replaced hg02207, former representative clones for KIAA0910 with hg02207s1. (2002/5/10)

Length: 6997 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	3048 bp
Genome contig ID	gi51511750r_32822944
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- GTGCTGTCATATGAAATAAATATATCTGTCTTTAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* CATGCTGACTTCTTTGTTAGAAAGGGAAGAATTTTTCTCAGCCATTTTCC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	21	r	32922944	33022105	33	99.5	Perfect prediction

Length: 1315 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG11257	100.0	synaptojanin-1 ...	synthetic construct
EDM10704	92.0	synaptojanin 1,...	Rattus norvegicus
XP_531429	96.3	synaptojanin 1 ...	Pan troglodytes
NP_982271	98.8	synaptojanin 1 ...	Homo sapiens
O43426	97.5	Synaptojanin-1;...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002346	1.5e-63	47.6	KIAA0348
AB020658	4.3e-08	30.6	KIAA0851
AB023183	5.4e-07	32.9	KIAA0966

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002013	95	383	PF02383	Synaptojanin
	IPR005135	571	902	PF03372	Endonuclease/exonuclease/phosphatase
	IPR015047	903	1045	PF08952	Domain of unknown function DUF1866
HMMSmart	IPR000300	567	910	SM00128	Inositol polyphosphate related phosphatase
ProfileScan	IPR002013	155	478	PS50275	Synaptojanin
ProfileScan	IPR000504	938	1007	PS50102	RNA recognition motif

Primer_f	AAGGCACATACCACCAAGTTC
Primer_r	TAGATGTGTTATGTAGCCTCG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	ATCAGCAGCCCAGCCTTTATC
Primer_r	ACAGAGTTCACAAAGAGATCC
PCR product length	183 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles