KIAA0966

Product ID	ORK01139
Accession No	AB023183
Description	inositol polyphosphate-5-phosphatase F, transcript variant 1
Clone name	hj06369
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4924 bp) Predicted protein sequence (1150 aa)
HaloTag ORF Clone	FHC01139
Flexi ORF Clone	FXC01139
Source	Human adult brain
Rouge ID	mKIAA0966 by Kazusa Mouse cDNA Project

Length: 4924 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1359 bp
Genome contig ID	gi89161187f_121375599
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- CTTGTGATTATTAAAATAAAGTACCATTGTAATTT
Flanking genome sequence (203045 - 203094)	----+--------+--------+--------+--------+----* AAAGTGACAAATGGGTATGAGAATTCCTTGCATAACAGATTAAAGAATTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	10	f	121475599	121578642	20	99.5	Perfect prediction

Length: 1150 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9Y2H2	100.0	Phosphatidylino...	Homo sapiens
AAI11494	99.8	Inositol polyph...	Homo sapiens
XP_508074	99.6	inositol polyph...	Pan troglodytes
XP_001099262	98.0	similar to inos...	Macaca mulatta
XP_001927491	94.1	inositol polyph...	Sus scrofa

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020658	1.3e-37	38.0	KIAA0851
AB020717	1.1e-22	33.0	KIAA0910
AB002346	4.3e-22	32.1	KIAA0348
D87464	4.3e-07	25.8	KIAA0274

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002013	66	440	PF02383	Synaptojanin
ProfileScan	IPR002013	185	536	PS50275	Synaptojanin

Primer_f	TGCAGATGCTTAGGGGATTAG
Primer_r	GTCAATAACCCTCAACTCCTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-