KIAA0274

Product ID	ORK05023
Accession No	D87464
Description	FIG4 phosphoinositide 5-phosphatase
Clone name	ha06690
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pSPORT1 vector (GenBank Accession No. U12390, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3010 bp) Predicted protein sequence (932 aa)
Source	Human adult brain
Rouge ID	mKIAA0274 by Kazusa Mouse cDNA Project

Length: 3010 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	162 bp
Genome contig ID	gi89161210f_110019208
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- TTCCAAATTATAGCTAATAAAGATGACTAGATAAC
Flanking genome sequence (234116 - 234165)	----+--------+--------+--------+--------+----* TTTGCTGTTGTTGCCTTTGCTTTATTTTAGAAATACTTTGTTTACAAATG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	6	f	110119208	110253322	23	99.9	Perfect prediction

Length: 932 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
NP_001108096	99.8	FIG4 homolog [P...	Pan troglodytes
BAF84360	99.6	unnamed protein...	Homo sapiens
BAD96452	99.6	Sac domain-cont...	Homo sapiens
NP_001108097	98.0	FIG4 homolog [C...	Canis lupus fam...
AAI14695	96.9	FIG4 homolog (S...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023183	2.5e-08	26.0	KIAA0966
AB020658	2.7e-08	28.6	KIAA0851
AB020717	8.9e-06	27.3	KIAA0910
AB002346	7.6e-05	26.8	KIAA0348

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002013	117	455	PF02383	Synaptojanin
ProfileScan	IPR002013	179	572	PS50275	Synaptojanin

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	TCAGCCCCCAAGAGTAGACAG
Primer_r	GCGGTTCCTGATGTACTCTCG
PCR product length	127 bp
PCR conditions	95 °C15 sec68 °C60 sec30 cycles