KIAA0925

Product ID	ORK00147
Accession No	AB023142
Description	coronin, actin binding protein, 2B, transcript variant 2
Clone name	hh02949
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3269 bp) Predicted protein sequence (479 aa)
HaloTag ORF Clone	FHC00147
Flexi ORF Clone	FXC00147
Source	Human adult brain

Length: 3269 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	1828 bp
Genome contig ID	gi51511731f_66624551
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- AAGGATAGAATTGAAATAAAATGTTTTCAACTTAT
Flanking genome sequence (182646 - 182695)	----+--------+--------+--------+--------+----* CAAACCTGGGCATAGCCATCTCATTTAACCCCAGTGGTTCCTGTTCTTGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	15	f	66724542	66807195	11	99.2	Perfect prediction

Length: 479 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
NP_006082	4.9e-205	100.0	coronin, actin ...	Homo sapiens
Q9UQ03	1.2e-203	100.0	Coronin-2B; Cor...	Homo sapiens
AAH26335	2.1e-203	99.8	Coronin, actin ...	Homo sapiens
BAA36341	3.3e-203	99.8	ClipinC [Homo s...	Homo sapiens
EDL26025	7.2e-203	98.1	coronin, actin ...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB075822	1.4e-05	28.2	KIAA1942

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001680	84	116	PD000018	WD40 repeat
BlastProDom	IPR001680	132	166	PD000018	WD40 repeat
FPrintScan	IPR001680	102	116	PR00320	WD40 repeat
	IPR001680	152	166	PR00320	WD40 repeat
	IPR001680	285	299	PR00320	WD40 repeat
HMMPfam	IPR015048	9	74	PF08953	Domain of unknown function DUF1899
	IPR001680	76	115	PF00400	WD40 repeat
	IPR001680	126	165	PF00400	WD40 repeat
	IPR001680	169	207	PF00400	WD40 repeat
	IPR015049	260	396	PF08954	Domain of unknown function DUF1900
HMMSmart	IPR001680	72	115	SM00320	WD40 repeat
	IPR001680	125	165	SM00320	WD40 repeat
	IPR001680	168	207	SM00320	WD40 repeat
	IPR001680	210	253	SM00320	WD40 repeat
ProfileScan	IPR001680	82	124	PS50082	WD40 repeat
	IPR001680	82	216	PS50294	WD40 repeat
	IPR001680	132	174	PS50082	WD40 repeat
	IPR001680	175	216	PS50082	WD40 repeat
ScanRegExp	IPR001680	102	116	PS00678	WD40 repeat
ScanRegExp	IPR001680	152	166	PS00678	WD40 repeat

Primer_f	GAGCTGGGCCTTTCCTTTATG
Primer_r	AATCACAGAAGACCACAAAGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-