KIAA1942

Product ID	ORK00951
Accession No	AB075822
Description	glutamate-rich WD repeat containing 1
Clone name	fg00781
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5549 bp) Predicted protein sequence (445 aa)
HaloTag ORF Clone	FHC00951
Flexi ORF Clone	FXC00951
Source	Human fetal brain
Rouge ID	mKIAA1942 by Kazusa Mouse cDNA Project

Length: 5549 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	4210 bp
Genome contig ID	gi42406306f_53541077
PolyA signal sequence (None)	+--------+--------+----*----+---- CTCCAGCTTGGGCGACAGAGCGAGACTCTGTCTCC
Flanking genome sequence (115522 - 115571)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAAATGCGTATCGTTCCACCTATTTGACAGAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	19	f	53641077	53656597	8	99.0	Perfect prediction

Length: 445 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAG10184	8.7e-183	100.0	glutamate-rich ...	synthetic construct
Q9BQ67	2.1e-182	99.8	Glutamate-rich ...	Homo sapiens
CAD28519	4.2e-182	99.6	hypothetical pr...	Homo sapiens
BAG37993	4.2e-182	99.6	unnamed protein...	Homo sapiens
BAC11130	1.8e-181	99.3	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB033068	2e-05	26.2	KIAA1242
AB023142	0.00053	28.2	KIAA0925

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001680	256	290	PD000018	WD40 repeat
FPrintScan	IPR001680	276	290	PR00320	WD40 repeat
	IPR001680	322	336	PR00320	WD40 repeat
	IPR001680	368	382	PR00320	WD40 repeat
HMMPfam	IPR001680	203	242	PF00400	WD40 repeat
	IPR001680	250	289	PF00400	WD40 repeat
	IPR001680	297	335	PF00400	WD40 repeat
	IPR001680	342	381	PF00400	WD40 repeat
HMMSmart	IPR001680	202	242	SM00320	WD40 repeat
	IPR001680	248	289	SM00320	WD40 repeat
	IPR001680	296	335	SM00320	WD40 repeat
	IPR001680	341	381	SM00320	WD40 repeat
ProfileScan	IPR001680	209	390	PS50294	WD40 repeat
	IPR001680	256	291	PS50082	WD40 repeat
	IPR001680	303	337	PS50082	WD40 repeat
	IPR001680	348	382	PS50082	WD40 repeat
ScanRegExp	IPR001680	322	336	PS00678	WD40 repeat

Primer_f	CAACAGACTGATGATGCTTCG
Primer_r	GGTTTCCGCTCTTCTTCATCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-