Order Kazusa clone(s) from : ![]() |
Product ID | ORK00148 |
---|---|
Accession No | AB023143 |
Description | NLR family, pyrin domain containing 1, transcript variant 2 |
Clone name | hh02962 |
Vector information | |
cDNA sequence | DNA sequence (5444 bp) Predicted protein sequence (1447 aa) |
Flexi ORF Clone | FXC00148 |
Source | Human adult brain |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 632 bp |
---|---|
Genome contig ID | gi51511734r_5258396 |
PolyA signal sequence (AATAAA,-25) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (99770 - 99721) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 17 | r | 5358166 | 5428523 | 16 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR000767 | 347 | 362 | PR00364 | Disease resistance protein |
IPR000767 | 417 | 431 | PR00364 | Disease resistance protein | |
IPR000767 | 823 | 839 | PR00364 | Disease resistance protein | |
IPR001611 | 828 | 841 | PR00019 | Leucine-rich repeat | |
IPR001611 | 939 | 952 | PR00019 | Leucine-rich repeat | |
HMMPfam | IPR004020 | 23 | 106 | PF02758 | Pyrin |
IPR007111 | 346 | 515 | PF05729 | NACHT nucleoside triphosphatase | |
IPR001611 | 827 | 850 | PF00560 | Leucine-rich repeat | |
IPR001611 | 884 | 907 | PF00560 | Leucine-rich repeat | |
IPR001611 | 941 | 959 | PF00560 | Leucine-rich repeat | |
IPR001315 | 1353 | 1436 | PF00619 | Caspase Recruitment | |
HMMSmart | IPR003590 | 825 | 852 | SM00368 | Leucine-rich repeat |
IPR003590 | 854 | 881 | SM00368 | Leucine-rich repeat | |
IPR003590 | 882 | 909 | SM00368 | Leucine-rich repeat | |
IPR003590 | 911 | 938 | SM00368 | Leucine-rich repeat | |
IPR003590 | 939 | 966 | SM00368 | Leucine-rich repeat | |
ProfileScan | IPR004020 | 19 | 110 | PS50824 | Pyrin |
IPR007111 | 346 | 655 | PS50837 | NACHT nucleoside triphosphatase | |
IPR001315 | 1354 | 1437 | PS50209 | Caspase Recruitment |
![]() |
Primer_f | ATCTCATGCCTGCAACTACTC |
---|---|
Primer_r | CAACCTCCACCGATGTCACTC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | ATCTCATGCCTGCAACTACTC |
Primer_r | CAACCTCCACCGATGTCACTC |
PCR product length | 135 (0.5k) bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |