Order Kazusa clone(s) from : 
Japan
||
Other countries |
|
Order Kazusa clone(s) from :
Japan
||
Other countries |
| Product ID | ORK00686 |
|---|---|
| Accession No | AB023144 |
| Description | seizure related 6 homolog (mouse)-like, transcript variant 5 |
| Clone name | hg03734 |
| Vector information |
The cDNA fragment was inserted at the SalI-NotI site of the ...
|
| cDNA sequence | DNA sequence (6301 bp) Predicted protein sequence (1001 aa) |
|
HaloTag ORF Clone |
FHC00686
|
| Flexi ORF Clone | FXC00686 |
| Source | Human adult brain |
| Rouge ID |
mKIAA0927
by Kazusa Mouse cDNA Project
|
| Note | We replaced hh02994, former representative clones for KIAA0927 with hg03734. (2001/5/29) |
Length: 6301 bp Physical map
Restriction map Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | Warning | No warning |
Integrity of 3' end
| Length of 3'UTR | 3295 bp |
|---|---|
| Genome contig ID | gi89161203f_24795480 |
| PolyA signal sequence (AATAAA,-19) |
+----*----+----*----+----*----+---- |
| Flanking genome sequence (314083 - 314132) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
| Chr | f/r | start | end | exon | identity | class | |
|---|---|---|---|---|---|---|---|
|
| 22 | f | 24895480 | 25109561 | 15 | 99.3 | Perfect prediction |
Length: 1001 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment) |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database
(FASTA output,
Multiple alignment)The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI) Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| HMMPfam | IPR000436 | 445 | 500 | PF00084 | Sushi/SCR/CCP |
| IPR000859 | 504 | 548 | PF00431 | CUB | |
| IPR000436 | 619 | 676 | PF00084 | Sushi/SCR/CCP | |
| IPR000859 | 680 | 772 | PF00431 | CUB | |
| IPR000436 | 797 | 852 | PF00084 | Sushi/SCR/CCP | |
| IPR000436 | 861 | 918 | PF00084 | Sushi/SCR/CCP | |
| HMMSmart | IPR000859 | 333 | 441 | SM00042 | CUB |
| IPR000436 | 445 | 500 | SM00032 | Sushi/SCR/CCP | |
| IPR000859 | 504 | 614 | SM00042 | CUB | |
| IPR000436 | 619 | 676 | SM00032 | Sushi/SCR/CCP | |
| IPR000859 | 680 | 791 | SM00042 | CUB | |
| IPR000436 | 797 | 852 | SM00032 | Sushi/SCR/CCP | |
| IPR000436 | 861 | 918 | SM00032 | Sushi/SCR/CCP | |
| ProfileScan | IPR000859 | 333 | 441 | PS01180 | CUB |
| IPR000436 | 443 | 502 | PS50923 | Sushi/SCR/CCP | |
| IPR000859 | 504 | 614 | PS01180 | CUB | |
| IPR000436 | 617 | 678 | PS50923 | Sushi/SCR/CCP | |
| IPR000859 | 680 | 791 | PS01180 | CUB | |
| IPR000436 | 795 | 854 | PS50923 | Sushi/SCR/CCP | |
| IPR000436 | 859 | 920 | PS50923 | Sushi/SCR/CCP |
Prediction of transmembrane (TM) segments| Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 934 | MALAIFIPVLIISLLLGGAYIYI | 956 | PRIMARY | 23 |
|---|
|
RT-PCR-ELISA
|
Experimental conditions| Primer_f | TGCATAATCAGGAGGGTTGTA |
|---|---|
| Primer_r | TATCTGACCTCAAATGACTCG |
| PCR conditions | 95 °C 30 sec55 °C30 sec72 °C60 sec30 cycles |
Chromosome No. 22 Experimental conditions| Panel name | UniGene |
|---|---|
| Primer_f | - |
| Primer_r | - |
| PCR product length | - |
| PCR conditions | - |
Japan
||
Other countries
