Order Kazusa clone(s) from : ![]() |
Product ID | ORK04656 |
---|---|
Accession No | AB067481 |
Description | CUB and Sushi multiple domains 3 |
Clone name | ff08107 |
Vector information | |
cDNA sequence | DNA sequence (10774 bp) Predicted protein sequence (2977 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA1894
by Kazusa Mouse cDNA Project
|
Note | We replaced fk04407, former representative clones for KIAA1894 with ff08107. (2003/8/28) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1840 bp |
---|---|
Genome contig ID | gi51511724r_113204337 |
PolyA signal sequence (AATAAA,-25) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 8 | r | 113304337 | 113771447 | 56 | 99.8 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000436 | 4 | 57 | PF00084 | Sushi/SCR/CCP |
IPR000859 | 61 | 166 | PF00431 | CUB | |
IPR000436 | 174 | 231 | PF00084 | Sushi/SCR/CCP | |
IPR000859 | 235 | 340 | PF00431 | CUB | |
IPR000436 | 350 | 403 | PF00084 | Sushi/SCR/CCP | |
IPR000859 | 407 | 514 | PF00431 | CUB | |
IPR000436 | 522 | 577 | PF00084 | Sushi/SCR/CCP | |
IPR000859 | 581 | 686 | PF00431 | CUB | |
IPR000436 | 694 | 750 | PF00084 | Sushi/SCR/CCP | |
IPR000859 | 754 | 860 | PF00431 | CUB | |
IPR000436 | 868 | 924 | PF00084 | Sushi/SCR/CCP | |
IPR000859 | 928 | 1033 | PF00431 | CUB | |
IPR000436 | 1041 | 1098 | PF00084 | Sushi/SCR/CCP | |
IPR000859 | 1102 | 1140 | PF00431 | CUB | |
IPR000436 | 1148 | 1205 | PF00084 | Sushi/SCR/CCP | |
IPR000859 | 1209 | 1314 | PF00431 | CUB | |
IPR000436 | 1322 | 1377 | PF00084 | Sushi/SCR/CCP | |
IPR000859 | 1381 | 1486 | PF00431 | CUB | |
IPR000436 | 1494 | 1549 | PF00084 | Sushi/SCR/CCP | |
IPR000859 | 1553 | 1657 | PF00431 | CUB | |
IPR000436 | 1665 | 1722 | PF00084 | Sushi/SCR/CCP | |
IPR000859 | 1734 | 1834 | PF00431 | CUB | |
IPR000436 | 1839 | 1897 | PF00084 | Sushi/SCR/CCP | |
IPR000436 | 1902 | 1959 | PF00084 | Sushi/SCR/CCP | |
IPR000436 | 1964 | 2024 | PF00084 | Sushi/SCR/CCP | |
IPR000436 | 2029 | 2082 | PF00084 | Sushi/SCR/CCP | |
IPR000436 | 2087 | 2140 | PF00084 | Sushi/SCR/CCP | |
IPR000436 | 2145 | 2198 | PF00084 | Sushi/SCR/CCP | |
IPR000436 | 2203 | 2260 | PF00084 | Sushi/SCR/CCP | |
IPR000436 | 2265 | 2318 | PF00084 | Sushi/SCR/CCP | |
IPR000436 | 2326 | 2379 | PF00084 | Sushi/SCR/CCP | |
IPR000436 | 2384 | 2438 | PF00084 | Sushi/SCR/CCP | |
IPR000436 | 2443 | 2498 | PF00084 | Sushi/SCR/CCP | |
IPR000436 | 2503 | 2556 | PF00084 | Sushi/SCR/CCP | |
IPR000436 | 2561 | 2614 | PF00084 | Sushi/SCR/CCP | |
IPR000436 | 2622 | 2676 | PF00084 | Sushi/SCR/CCP | |
IPR000436 | 2681 | 2736 | PF00084 | Sushi/SCR/CCP | |
HMMSmart | IPR000436 | 4 | 57 | SM00032 | Sushi/SCR/CCP |
IPR000859 | 61 | 169 | SM00042 | CUB | |
IPR000436 | 174 | 231 | SM00032 | Sushi/SCR/CCP | |
IPR000859 | 235 | 343 | SM00042 | CUB | |
IPR000436 | 350 | 403 | SM00032 | Sushi/SCR/CCP | |
IPR000859 | 407 | 517 | SM00042 | CUB | |
IPR000436 | 522 | 577 | SM00032 | Sushi/SCR/CCP | |
IPR000859 | 581 | 689 | SM00042 | CUB | |
IPR000436 | 694 | 750 | SM00032 | Sushi/SCR/CCP | |
IPR000859 | 754 | 863 | SM00042 | CUB | |
IPR000436 | 868 | 924 | SM00032 | Sushi/SCR/CCP | |
IPR000859 | 928 | 1036 | SM00042 | CUB | |
IPR000436 | 1041 | 1098 | SM00032 | Sushi/SCR/CCP | |
IPR000436 | 1148 | 1205 | SM00032 | Sushi/SCR/CCP | |
IPR000859 | 1209 | 1317 | SM00042 | CUB | |
IPR000436 | 1322 | 1377 | SM00032 | Sushi/SCR/CCP | |
IPR000859 | 1381 | 1489 | SM00042 | CUB | |
IPR000436 | 1494 | 1549 | SM00032 | Sushi/SCR/CCP | |
IPR000859 | 1553 | 1660 | SM00042 | CUB | |
IPR000436 | 1665 | 1722 | SM00032 | Sushi/SCR/CCP | |
IPR000859 | 1727 | 1837 | SM00042 | CUB | |
IPR000436 | 1839 | 1897 | SM00032 | Sushi/SCR/CCP | |
IPR000436 | 1902 | 1959 | SM00032 | Sushi/SCR/CCP | |
IPR000436 | 1964 | 2024 | SM00032 | Sushi/SCR/CCP | |
IPR000436 | 2029 | 2082 | SM00032 | Sushi/SCR/CCP | |
IPR000436 | 2087 | 2140 | SM00032 | Sushi/SCR/CCP | |
IPR000436 | 2145 | 2198 | SM00032 | Sushi/SCR/CCP | |
IPR000436 | 2203 | 2260 | SM00032 | Sushi/SCR/CCP | |
IPR000436 | 2265 | 2318 | SM00032 | Sushi/SCR/CCP | |
IPR000436 | 2326 | 2379 | SM00032 | Sushi/SCR/CCP | |
IPR000436 | 2384 | 2438 | SM00032 | Sushi/SCR/CCP | |
IPR000436 | 2443 | 2498 | SM00032 | Sushi/SCR/CCP | |
IPR000436 | 2503 | 2556 | SM00032 | Sushi/SCR/CCP | |
IPR000436 | 2561 | 2614 | SM00032 | Sushi/SCR/CCP | |
IPR000436 | 2622 | 2676 | SM00032 | Sushi/SCR/CCP | |
IPR000436 | 2681 | 2736 | SM00032 | Sushi/SCR/CCP | |
ProfileScan | IPR000436 | 2 | 59 | PS50923 | Sushi/SCR/CCP |
IPR000859 | 61 | 169 | PS01180 | CUB | |
IPR000436 | 172 | 233 | PS50923 | Sushi/SCR/CCP | |
IPR000859 | 235 | 343 | PS01180 | CUB | |
IPR000436 | 348 | 405 | PS50923 | Sushi/SCR/CCP | |
IPR000859 | 407 | 517 | PS01180 | CUB | |
IPR000436 | 520 | 579 | PS50923 | Sushi/SCR/CCP | |
IPR000859 | 581 | 689 | PS01180 | CUB | |
IPR000436 | 692 | 752 | PS50923 | Sushi/SCR/CCP | |
IPR000859 | 754 | 863 | PS01180 | CUB | |
IPR000436 | 866 | 926 | PS50923 | Sushi/SCR/CCP | |
IPR000859 | 928 | 1036 | PS01180 | CUB | |
IPR000436 | 1039 | 1100 | PS50923 | Sushi/SCR/CCP | |
IPR000859 | 1102 | 1135 | PS01180 | CUB | |
IPR000436 | 1146 | 1207 | PS50923 | Sushi/SCR/CCP | |
IPR000859 | 1209 | 1317 | PS01180 | CUB | |
IPR000436 | 1320 | 1379 | PS50923 | Sushi/SCR/CCP | |
IPR000859 | 1381 | 1489 | PS01180 | CUB | |
IPR000436 | 1492 | 1551 | PS50923 | Sushi/SCR/CCP | |
IPR000859 | 1553 | 1664 | PS01180 | CUB | |
IPR000436 | 1663 | 1724 | PS50923 | Sushi/SCR/CCP | |
IPR000859 | 1726 | 1837 | PS01180 | CUB | |
IPR000436 | 1837 | 1899 | PS50923 | Sushi/SCR/CCP | |
IPR000436 | 1900 | 1961 | PS50923 | Sushi/SCR/CCP | |
IPR000436 | 1962 | 2026 | PS50923 | Sushi/SCR/CCP | |
IPR000436 | 2027 | 2084 | PS50923 | Sushi/SCR/CCP | |
IPR000436 | 2085 | 2142 | PS50923 | Sushi/SCR/CCP | |
IPR000436 | 2143 | 2200 | PS50923 | Sushi/SCR/CCP | |
IPR000436 | 2201 | 2262 | PS50923 | Sushi/SCR/CCP | |
IPR000436 | 2263 | 2320 | PS50923 | Sushi/SCR/CCP | |
IPR000436 | 2324 | 2381 | PS50923 | Sushi/SCR/CCP | |
IPR000436 | 2382 | 2440 | PS50923 | Sushi/SCR/CCP | |
IPR000436 | 2441 | 2500 | PS50923 | Sushi/SCR/CCP | |
IPR000436 | 2501 | 2558 | PS50923 | Sushi/SCR/CCP | |
IPR000436 | 2559 | 2616 | PS50923 | Sushi/SCR/CCP | |
IPR000436 | 2620 | 2678 | PS50923 | Sushi/SCR/CCP | |
IPR000436 | 2679 | 2738 | PS50923 | Sushi/SCR/CCP | |
ScanRegExp | IPR001000 | 509 | 519 | PS00591 | Glycoside hydrolase |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 2900 | SVAIAILVPFFALIFAGFGF | 2919 | PRIMARY | 20 |
---|
![]() |
Primer_f | ATTATTCAGTGAGCTATGGGG |
---|---|
Primer_r | GGATGGTAAGTTTGGTGTCTC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | genbank |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |