KIAA1890

Product ID	ORK04654
Accession No	AB067477
Description	CUB and Sushi multiple domains 1
Clone name	fk02692
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3289 bp) Predicted protein sequence (1048 aa)
Source	Human fetal brain
Rouge ID	mKIAA1890 by Kazusa Mouse cDNA Project

Length: 3289 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	142 bp
Genome contig ID	gi51511724r_2896176
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- GTGGCGTACAGATTTAAATAAAGCTTTGGCAGAGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACTTTGAGAGTGGAAAACTTATTTGAAAAATCAATTAAGCCATGCAACT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	8	r	2996176	3212178	21	100.0	Terminal No-hit

Length: 1048 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAQ88541	100.0	CSMD1 [Homo sap...	Homo sapiens
BAD92739	100.0	CUB and Sushi m...	Homo sapiens
EAW80463	100.0	CUB and Sushi m...	Homo sapiens
NP_150094	100.0	CUB and Sushi m...	Homo sapiens
Q96PZ7	99.9	CUB and sushi d...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB067481	9.2e-211	64.2	KIAA1894
AB023144	4.9e-54	32.3	KIAA0927
AB023149	4.6e-16	25.3	KIAA0932
AB067471	1.5e-11	23.0	KIAA1884
AB011541	7.1e-06	27.7	KIAA0817

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000436	81	136	PF00084	Sushi/SCR/CCP
	IPR000859	140	245	PF00431	CUB
	IPR000436	253	309	PF00084	Sushi/SCR/CCP
	IPR000859	313	419	PF00431	CUB
	IPR000436	427	483	PF00084	Sushi/SCR/CCP
	IPR000859	487	592	PF00431	CUB
	IPR000436	600	657	PF00084	Sushi/SCR/CCP
	IPR000859	661	766	PF00431	CUB
	IPR000436	777	834	PF00084	Sushi/SCR/CCP
	IPR000859	838	943	PF00431	CUB
	IPR000436	951	1006	PF00084	Sushi/SCR/CCP
	IPR000859	1010	1046	PF00431	CUB
HMMSmart	IPR000436	81	136	SM00032	Sushi/SCR/CCP
	IPR000859	140	248	SM00042	CUB
	IPR000436	253	309	SM00032	Sushi/SCR/CCP
	IPR000859	313	422	SM00042	CUB
	IPR000436	427	483	SM00032	Sushi/SCR/CCP
	IPR000859	487	595	SM00042	CUB
	IPR000436	600	657	SM00032	Sushi/SCR/CCP
	IPR000859	661	769	SM00042	CUB
	IPR000436	777	834	SM00032	Sushi/SCR/CCP
	IPR000859	838	946	SM00042	CUB
	IPR000436	951	1006	SM00032	Sushi/SCR/CCP
ProfileScan	IPR000436	79	138	PS50923	Sushi/SCR/CCP
	IPR000859	140	248	PS01180	CUB
	IPR000436	251	311	PS50923	Sushi/SCR/CCP
	IPR000859	313	422	PS01180	CUB
	IPR000436	425	485	PS50923	Sushi/SCR/CCP
	IPR000859	487	595	PS01180	CUB
	IPR000436	598	659	PS50923	Sushi/SCR/CCP
	IPR000859	661	769	PS01180	CUB
	IPR000436	775	836	PS50923	Sushi/SCR/CCP
	IPR000859	838	946	PS01180	CUB
	IPR000436	949	1008	PS50923	Sushi/SCR/CCP
	IPR000859	1010	1048	PS01180	CUB
ScanRegExp	IPR001000	68	78	PS00591	Glycoside hydrolase

Primer_f	CCCAGCTATGACTTCCTACAC
Primer_r	GTCAAAACAAGCTTCCCGTGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-