Order Kazusa clone(s) from : ![]() |
Product ID | ORK06506 |
---|---|
Accession No | AB023159 |
Description | pleckstrin and Sec7 domain containing 3 |
Clone name | hh04979s1 |
Vector information | |
cDNA sequence | DNA sequence (6670 bp) Predicted protein sequence (537 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA0942
by Kazusa Mouse cDNA Project
|
Note | We replaced hh04979, former representative clones for KIAA0942 with hh04979s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 5038 bp |
---|---|
Genome contig ID | gi51511724r_18332500 |
PolyA signal sequence (AATACA,-7) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 8 | r | 18432500 | 18710666 | 13 | 99.2 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR001605 | 277 | 296 | PR00683 | Spectrin/pleckstrin-like |
IPR001605 | 342 | 359 | PR00683 | Spectrin/pleckstrin-like | |
IPR001605 | 362 | 380 | PR00683 | Spectrin/pleckstrin-like | |
HMMPfam | IPR000904 | 40 | 225 | PF01369 | SEC7-like |
IPR001849 | 275 | 387 | PF00169 | Pleckstrin-like | |
HMMSmart | IPR000904 | 38 | 225 | SM00222 | SEC7-like |
IPR001849 | 275 | 389 | SM00233 | Pleckstrin-like | |
ProfileScan | IPR000904 | 38 | 223 | PS50190 | SEC7-like |
IPR001849 | 274 | 387 | PS50003 | Pleckstrin-like |
![]() |
Primer_f | ATGAAAAGCAAGTACAACCTC |
---|---|
Primer_r | CACTGCAAAAGATTCACAAGG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | UniGene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |