Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK00155 |
---|---|
Accession No | AB023163 |
Description | zinc finger, DHHC-type containing 17 |
Clone name | hj04787 |
Vector information | |
cDNA sequence | DNA sequence (4715 bp) Predicted protein sequence (667 aa) |
HaloTag ORF Clone |
FHC00155
|
Flexi ORF Clone | FXC00155 |
Source | Human adult brain |
Rouge ID |
mKIAA0946
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 2709 bp |
---|---|
Genome contig ID | gi89161190f_75582041 |
PolyA signal sequence (AATAAA,-17) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (189566 - 189615) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 12 | f | 75682041 | 75771605 | 17 | 100.0 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR001594 | 431 | 504 | PD003041 | Zinc finger |
FPrintScan | IPR002110 | 159 | 171 | PR01415 | Ankyrin |
IPR002110 | 272 | 284 | PR01415 | Ankyrin | |
HMMPfam | IPR002110 | 124 | 156 | PF00023 | Ankyrin |
IPR002110 | 158 | 190 | PF00023 | Ankyrin | |
IPR002110 | 191 | 223 | PF00023 | Ankyrin | |
IPR002110 | 224 | 257 | PF00023 | Ankyrin | |
IPR002110 | 259 | 291 | PF00023 | Ankyrin | |
IPR001594 | 468 | 527 | PF01529 | Zinc finger | |
HMMSmart | IPR002110 | 124 | 153 | SM00248 | Ankyrin |
IPR002110 | 158 | 187 | SM00248 | Ankyrin | |
IPR002110 | 191 | 220 | SM00248 | Ankyrin | |
IPR002110 | 224 | 254 | SM00248 | Ankyrin | |
IPR002110 | 259 | 288 | SM00248 | Ankyrin | |
ProfileScan | IPR002110 | 99 | 312 | PS50297 | Ankyrin |
IPR002110 | 124 | 156 | PS50088 | Ankyrin | |
IPR002110 | 158 | 190 | PS50088 | Ankyrin | |
IPR002110 | 191 | 223 | PS50088 | Ankyrin | |
IPR002110 | 224 | 257 | PS50088 | Ankyrin | |
IPR002110 | 259 | 291 | PS50088 | Ankyrin | |
IPR001594 | 472 | 522 | PS50216 | Zinc finger |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 339 | KVMLGTPFLVIWLVGFIADLNID | 361 | PRIMARY | 23 | 2 | 363 | WLIKGLMYGGVWATVQFLSKSFF | 385 | SECONDARY | 23 | 3 | 392 | ALPLGIYLATKFWMYVTWFFWFW | 414 | SECONDARY | 23 | 4 | 417 | LNFLFIHLPFLANSVALFYNFGK | 439 | SECONDARY | 23 | 5 | 515 | RYFMGYLFFLLFMICWMIYGCIS | 537 | PRIMARY | 23 | 6 | 571 | LNSVFHFMWVAVLLMCQMYQISC | 593 | PRIMARY | 23 |
---|
RT-PCR-ELISA |
Primer_f | AAATGGTCAGATGGTCAGGAG |
---|---|
Primer_r | CCCAAAGGTTCACCATCATAC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | UniGene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |