KIAA0975

Product ID	ORK01618
Accession No	AB023192
Description	nischarin, transcript variant 1
Clone name	hj06890
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5161 bp) Predicted protein sequence (1528 aa)
HaloTag ORF Clone	FHC01618
Flexi ORF Clone	FXC01618
Source	Human adult brain
Rouge ID	mKIAA0975 by Kazusa Mouse cDNA Project

Length: 5161 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	574 bp
Genome contig ID	gi89161205f_52364661
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- TTCTCTATTCCAATAAAGCAGAGTTTGACACCGTC
Flanking genome sequence (137465 - 137514)	----+--------+--------+--------+--------+----* TGCATCTTCTAAACCAAGGGTCACTGGGATCCCAGCAGGGCTTCCGTCCA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	f	52464174	52502124	22	99.1	Perfect prediction

Length: 1528 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG09925	100.0	nischarin [synt...	synthetic construct
AAC33104	99.9	I-1 receptor ca...	Homo sapiens
AAH56900	99.9	Nischarin [Homo...	Homo sapiens
Q9Y2I1	99.9	Nischarin; Imid...	Homo sapiens
AAH38102	99.9	Nischarin [Homo...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB067485	0.00016	26.8	KIAA1898

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001611	313	326	PR00019	Leucine-rich repeat
FPrintScan	IPR001611	355	368	PR00019	Leucine-rich repeat
HMMPfam	IPR001683	38	142	PF00787	Phox-like
	IPR001611	312	333	PF00560	Leucine-rich repeat
	IPR001611	335	355	PF00560	Leucine-rich repeat
	IPR001611	357	377	PF00560	Leucine-rich repeat
	IPR001611	380	400	PF00560	Leucine-rich repeat
	IPR001611	402	422	PF00560	Leucine-rich repeat
HMMSmart	IPR001683	38	142	SM00312	Phox-like
	NULL	310	328	SM00365	NULL
	IPR003591	310	332	SM00369	Leucine-rich repeat
	NULL	333	354	SM00365	NULL
	NULL	355	376	SM00365	NULL
	IPR003591	355	377	SM00369	Leucine-rich repeat
	NULL	378	399	SM00365	NULL
	IPR003591	378	399	SM00369	Leucine-rich repeat
	NULL	400	421	SM00365	NULL
	IPR003591	400	425	SM00369	Leucine-rich repeat
ProfileScan	IPR001683	35	145	PS50195	Phox-like
ScanRegExp	IPR001128	827	836	PS00086	Cytochrome P450

Primer_f	CCTTAATTTGACTGTCCTCGC
Primer_r	TAACAACGGTCCCACAACAGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-