KIAA0989

Product ID	ORK00709
Accession No	AB023206
Description	angiomotin like 2, transcript variant 2
Clone name	hk05377
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4412 bp) Predicted protein sequence (859 aa)
HaloTag ORF Clone	FHC00709
Flexi ORF Clone	FXC00709
Source	Human adult brain
Rouge ID	mKIAA0989 by Kazusa Mouse cDNA Project

Length: 4412 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	1831 bp
Genome contig ID	gi89161205r_135457406
PolyA signal sequence (ATTAAA,-10)	+--------+--------+----*----+---- ACAGTATTTTAATTAAAAAATAATAATTAAAAGTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATGTCTTTGCACAGGTGAGACTTTGCACTGAGGGAAGGGAAAGGGTGAGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	r	135557406	135576052	10	99.4	Perfect prediction

Length: 859 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAA76833	100.0	angiomotin like...	Homo sapiens
BAD97318	99.5	Angiomotin like...	Homo sapiens
BAH12987	96.5	unnamed protein...	Homo sapiens
XP_001112164	94.4	similar to angi...	Macaca mulatta
BAF84305	100.0	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB028994	4.8e-28	50.6	KIAA1071

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR009114	445	463	PR01807	Angiomotin
	IPR009114	468	483	PR01807	Angiomotin
	IPR009114	558	572	PR01807	Angiomotin
	IPR009114	574	591	PR01807	Angiomotin
	IPR009114	638	655	PR01807	Angiomotin
	IPR009114	659	676	PR01807	Angiomotin
	IPR009114	717	732	PR01807	Angiomotin

Primer_f	GTGGGTTTTAGCAGTTTTGTC
Primer_r	AGGAAACTTGAGGAACCATGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-