Order Kazusa clone(s) from : ![]() |
Product ID | ORK04095 |
---|---|
Accession No | AB028994 |
Description | angiomotin, transcript variant 2 |
Clone name | hj05664s2 |
Vector information | |
cDNA sequence | DNA sequence (5667 bp) Predicted protein sequence (675 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA1071
by Kazusa Mouse cDNA Project
|
Note | We replaced hj05664 and hj05664s1, former representative clones for KIAA1071 with hj05664s2. (2002/5/10,2003/4/2) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 3639 bp |
---|---|
Genome contig ID | gi89161218r_111804812 |
PolyA signal sequence (AATAAA,-25) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR009114 | 74 | 92 | PR01807 | Angiomotin |
IPR009114 | 97 | 112 | PR01807 | Angiomotin | |
IPR009114 | 187 | 201 | PR01807 | Angiomotin | |
IPR009114 | 203 | 220 | PR01807 | Angiomotin | |
IPR009114 | 262 | 279 | PR01807 | Angiomotin | |
IPR009114 | 283 | 300 | PR01807 | Angiomotin | |
IPR009114 | 348 | 363 | PR01807 | Angiomotin |
Primer_f | TAGGAAAGATACCCAGAGACC |
---|---|
Primer_r | CCGCATTATGAGGGTTTAGGC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | CCR |
---|---|
Primer_f | TAGGAAAGATACCCAGAGACC |
Primer_r | CCGCATTATGAGGGTTTAGGC |
PCR product length | 137 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |