Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK04095 |
---|---|
Accession No | AB028994 |
Description | angiomotin, transcript variant 2 |
Clone name | hj05664s2 |
Vector information | |
cDNA sequence | DNA sequence (5667 bp) Predicted protein sequence (675 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA1071
by Kazusa Mouse cDNA Project
|
Note | We replaced hj05664 and hj05664s1, former representative clones for KIAA1071 with hj05664s2. (2002/5/10,2003/4/2) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 3639 bp |
---|---|
Genome contig ID | gi89161218r_111804812 |
PolyA signal sequence (AATAAA,-25) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR009114 | 74 | 92 | PR01807 | Angiomotin |
IPR009114 | 97 | 112 | PR01807 | Angiomotin | |
IPR009114 | 187 | 201 | PR01807 | Angiomotin | |
IPR009114 | 203 | 220 | PR01807 | Angiomotin | |
IPR009114 | 262 | 279 | PR01807 | Angiomotin | |
IPR009114 | 283 | 300 | PR01807 | Angiomotin | |
IPR009114 | 348 | 363 | PR01807 | Angiomotin |
Primer_f | TAGGAAAGATACCCAGAGACC |
---|---|
Primer_r | CCGCATTATGAGGGTTTAGGC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | CCR |
---|---|
Primer_f | TAGGAAAGATACCCAGAGACC |
Primer_r | CCGCATTATGAGGGTTTAGGC |
PCR product length | 137 bp |
PCR conditions | 95 °C15 sec64 °C60 sec30 cycles |