Gene/Protein Characteristic Table for KIAA1071
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK04095
Accession No AB028994
Description angiomotin, transcript variant 2
Clone name hj05664s2
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (5667 bp)
Predicted protein sequence (675 aa)
Source Human adult brain
Rouge ID mKIAA1071 by Kazusa Mouse cDNA Project
Note We replaced hj05664 and hj05664s1, former representative clones for KIAA1071 with hj05664s2. (2002/5/10,2003/4/2)
Features of the cloned cDNA sequence
Description

Length: 5667 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Integrity of 3' end
Length of 3'UTR 3639 bp
Genome contig ID gi89161218r_111804812
PolyA signal sequence
(AATAAA,-25)
+----*----+----*----+----*----+----
AGCTAGTTCCAATAAAGTTAAGCAGGTTTAAATCC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACTTTGTGCCTATCTTTTCACTGACAATAAAGTTAGCTATTTTAAAATGC
Features of the protein sequence
Description

Length: 675 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q4VCS5 7.3e-143 100.0 Angiomotin.
Homo sapiens
AAI30295 1.4e-142 99.9 AMOT protein [H...
Homo sapiens
XP_879786 2.9e-130 92.0 similar to angi...
Bos taurus
XP_001924789 1.2e-129 92.2 angiomotin [Sus...
Sus scrofa
XP_001488656 6.4e-128 93.1 angiomotin [Equ...
Equus caballus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB023206 2.1e-22 50.6 KIAA0989
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR009114 74 92 PR01807 Angiomotin
IPR009114 97 112 PR01807 Angiomotin
IPR009114 187 201 PR01807 Angiomotin
IPR009114 203 220 PR01807 Angiomotin
IPR009114 262 279 PR01807 Angiomotin
IPR009114 283 300 PR01807 Angiomotin
IPR009114 348 363 PR01807 Angiomotin
Experimental conditions
Primer_f TAGGAAAGATACCCAGAGACC
Primer_r CCGCATTATGAGGGTTTAGGC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. X
Experimental conditions
Panel name CCR
Primer_f TAGGAAAGATACCCAGAGACC
Primer_r CCGCATTATGAGGGTTTAGGC
PCR product length 137 bp
PCR conditions 95 °C15 sec64 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp