KIAA1014

Product ID	ORK00713
Accession No	AB023231
Description	formin binding protein 4
Clone name	hk02388s2
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4145 bp) Predicted protein sequence (1050 aa)
HaloTag ORF Clone	FHC00713
Flexi ORF Clone	FXC00713
Source	Human adult brain
Rouge ID	mKIAA1014 by Kazusa Mouse cDNA Project
Note	We replaced hk02388, former representative clones for KIAA1014 with hk02388s2. (2002/5/10)

Length: 4145 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	902 bp
Genome contig ID	gi51511727r_47594662
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- GTATATATGCACTAATAAAGCTTTTTTTATAATCC
Flanking genome sequence (99986 - 99937)	----+--------+--------+--------+--------+----* TGATGGGTTATCCTTTTGCTCGTCAACTCCTGTTATTCTGATTATGTAAC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	11	r	47694648	47745605	17	99.8	Perfect prediction

Length: 1050 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8N3X1	100.0	Formin-binding ...	Homo sapiens
XP_508418	99.5	formin binding ...	Pan troglodytes
AAH37404	99.8	Formin binding ...	Homo sapiens
NP_056123	99.6	formin binding ...	Homo sapiens
CAB70761	99.8	hypothetical pr...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001202	249	279	PF00397	WW/Rsp5/WWP
HMMPfam	IPR001202	630	660	PF00397	WW/Rsp5/WWP
HMMSmart	IPR001202	248	281	SM00456	WW/Rsp5/WWP
HMMSmart	IPR001202	629	662	SM00456	WW/Rsp5/WWP
ProfileScan	IPR001202	253	281	PS50020	WW/Rsp5/WWP
ProfileScan	IPR001202	628	662	PS50020	WW/Rsp5/WWP
ScanRegExp	IPR001202	634	660	PS01159	WW/Rsp5/WWP

Primer_f	GAAGTGCTGAGGTCTAAGTGG
Primer_r	TAGTGTGCGAAACGACCGAGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-