Order Kazusa clone(s) from : ![]() |
Product ID | ORK00720 |
---|---|
Accession No | AB028967 |
Description | potassium channel, voltage gated Shal related subfamily D, member 2 |
Clone name | fh03989 |
Vector information | |
cDNA sequence | DNA sequence (5333 bp) Predicted protein sequence (646 aa) |
HaloTag ORF Clone |
FHC00720
![]() |
Flexi ORF Clone | FXC00720 |
Source | Human fetal brain |
Rouge ID |
mKIAA1044
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 2475 bp |
---|---|
Genome contig ID | gi89161213f_119600958 |
PolyA signal sequence (AATAAA,-29) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (576667 - 576716) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 7 | f | 119700958 | 120177623 | 6 | 99.5 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR004055 | 46 | 58 | PR01517 | Kv4.2 voltage-gated K+ channel |
IPR003975 | 84 | 97 | PR01497 | Shal voltage-gated K+ channel | |
IPR003968 | 98 | 108 | PR01491 | Kv channel | |
IPR003091 | 98 | 117 | PR00169 | Voltage-dependent potassium channel | |
IPR003975 | 159 | 175 | PR01497 | Shal voltage-gated K+ channel | |
IPR004055 | 164 | 180 | PR01517 | Kv4.2 voltage-gated K+ channel | |
IPR003975 | 177 | 191 | PR01497 | Shal voltage-gated K+ channel | |
IPR003091 | 194 | 222 | PR00169 | Voltage-dependent potassium channel | |
IPR003975 | 196 | 210 | PR01497 | Shal voltage-gated K+ channel | |
IPR003975 | 236 | 252 | PR01497 | Shal voltage-gated K+ channel | |
IPR003091 | 247 | 270 | PR00169 | Voltage-dependent potassium channel | |
IPR003091 | 273 | 293 | PR00169 | Voltage-dependent potassium channel | |
IPR003091 | 310 | 336 | PR00169 | Voltage-dependent potassium channel | |
IPR003968 | 315 | 323 | PR01491 | Kv channel | |
IPR003975 | 334 | 353 | PR01497 | Shal voltage-gated K+ channel | |
IPR003968 | 339 | 353 | PR01491 | Kv channel | |
IPR003091 | 339 | 362 | PR00169 | Voltage-dependent potassium channel | |
IPR003091 | 370 | 392 | PR00169 | Voltage-dependent potassium channel | |
IPR003091 | 399 | 425 | PR00169 | Voltage-dependent potassium channel | |
IPR003968 | 410 | 421 | PR01491 | Kv channel | |
IPR003975 | 431 | 442 | PR01497 | Shal voltage-gated K+ channel | |
IPR003975 | 445 | 461 | PR01497 | Shal voltage-gated K+ channel | |
IPR004055 | 477 | 489 | PR01517 | Kv4.2 voltage-gated K+ channel | |
IPR003975 | 491 | 505 | PR01497 | Shal voltage-gated K+ channel | |
IPR004055 | 576 | 589 | PR01517 | Kv4.2 voltage-gated K+ channel | |
IPR004055 | 596 | 608 | PR01517 | Kv4.2 voltage-gated K+ channel | |
HMMPfam | IPR003131 | 59 | 148 | PF02214 | K+ channel tetramerisation |
IPR005821 | 247 | 421 | PF00520 | Ion transport | |
HMMSmart | IPR000210 | 57 | 156 | SM00225 | BTB/POZ-like |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 12 | PLQVIMAAGVAAWLPFARAAAIG | 34 | PRIMARY | 23 | 2 | 201 | LVFYYVTGFFIAVSVIANVVETV | 223 | SECONDARY | 23 | 3 | 242 | AVAFFCLDTACVMIFTVEYLLRL | 264 | SECONDARY | 23 | 4 | 273 | FVRSVMSIIDVVAILPYYIGLVM | 295 | PRIMARY | 23 | 5 | 337 | ASELGFLLFSLTMAIIIFATVMF | 359 | PRIMARY | 23 | 6 | 369 | KFTSIPAAFWYTIVTMTTLGYGD | 391 | SECONDARY | 23 | 7 | 402 | FGSICSLSGVLVIALPVPVIVSN | 424 | PRIMARY | 23 |
---|
![]() |
Primer_f | CCTAGATACTGTTACAACTGC |
---|---|
Primer_r | CTACGAATGTGGCTCTTACCG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CCTAGATACTGTTACAACTGC |
Primer_r | CTACGAATGTGGCTCTTACCG |
PCR product length | 117 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |