KIAA1050

Product ID	ORK05632
Accession No	AB028973
Description	myelin transcription factor 1
Clone name	hh03308
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5969 bp) Predicted protein sequence (829 aa)
Source	Human adult brain

Length: 5969 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	3479 bp
Genome contig ID	gi51511747f_62209913
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- TGGTGTTTACCTTATGAAAATAAAGGATTGTAAGT
Flanking genome sequence (167536 - 167585)	----+--------+--------+--------+--------+----* AAAGTTTCCTGCGCACCTTATACCAGAATTCAGTATAATACACTACTTTC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	20	f	62309870	62377447	22	99.5	Perfect prediction

Length: 829 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q01538	100.0	Myelin transcri...	Homo sapiens
EDL07461	95.1	myelin transcri...	Mus musculus
EDL07462	95.1	myelin transcri...	Mus musculus
Q8CFC2	95.1	Myelin transcri...	Mus musculus
CAM20796	95.1	myelin transcri...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020642	3.6e-193	100.0	KIAA0835
AB029029	5.9e-89	57.2	KIAA1106
AB011107	9.1e-83	55.9	KIAA0535

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002515	147	177	PF01530	Zinc finger
	IPR002515	191	221	PF01530	Zinc finger
	IPR013681	268	482	PF08474	Myelin transcription factor 1
	IPR002515	505	535	PF01530	Zinc finger
	IPR002515	549	579	PF01530	Zinc finger
	IPR002515	598	628	PF01530	Zinc finger
	IPR002515	651	681	PF01530	Zinc finger

Primer_f	GCTAGGAAACATGTATTGCTC
Primer_r	AATAATGCCCACAAGGATCTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GCTAGGAAACATGTATTGCTC
Primer_r	AATAATGCCCACAAGGATCTC
PCR product length	172 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles