Gene/Protein Characteristic Table for KIAA0535
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00555
Accession No AB011107
Description suppression of tumorigenicity 18, zinc finger
Clone name hg03847
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (6183 bp)
Predicted protein sequence (1047 aa)
Flexi ORF Clone FXC00555
Source Human adult brain
Rouge ID mKIAA0535 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 6183 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Features of the protein sequence
Description

Length: 1047 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
XP_528132 0 99.5 suppression of ...
Pan troglodytes
XP_001488773 0 91.8 similar to Supp...
Equus caballus
XP_544076 0 92.9 similar to supp...
Canis lupus fam...
EDM11573 0 86.0 suppression of ...
Rattus norvegicus
NP_695222 0 85.9 suppression of ...
Rattus norvegicus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB020642 9.9e-101 45.7 KIAA0835
AB028973 3.7e-100 55.9 KIAA1050
AB029029 9.4e-91 43.1 KIAA1106
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR002515 365 395 PF01530 Zinc finger
IPR002515 409 439 PF01530 Zinc finger
IPR013681 478 716 PF08474 Myelin transcription factor 1
IPR002515 721 751 PF01530 Zinc finger
IPR002515 765 795 PF01530 Zinc finger
IPR002515 813 843 PF01530 Zinc finger
IPR002515 866 896 PF01530 Zinc finger
Expression profile
Description

RT-PCR
Experimental conditions
Primer_f ACCCACCATAGGAAACAAGAC
Primer_r TGAAGTGTGGATGAGTCTGTG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 8
Experimental conditions
Panel name GeneBridge 4
Primer_f ACCCACCATAGGAAACAAGAC
Primer_r TGAAGTGTGGATGAGTCTGTG
PCR product length 152 bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp