Order Kazusa clone(s) from : ![]() |
Product ID | ORK00555 |
---|---|
Accession No | AB011107 |
Description | suppression of tumorigenicity 18, zinc finger |
Clone name | hg03847 |
Vector information | |
cDNA sequence | DNA sequence (6183 bp) Predicted protein sequence (1047 aa) |
HaloTag ORF Clone |
FHC00555
![]() |
Flexi ORF Clone | FXC00555 |
Source | Human adult brain |
Rouge ID |
mKIAA0535
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR002515 | 365 | 395 | PF01530 | Zinc finger |
IPR002515 | 409 | 439 | PF01530 | Zinc finger | |
IPR013681 | 478 | 716 | PF08474 | Myelin transcription factor 1 | |
IPR002515 | 721 | 751 | PF01530 | Zinc finger | |
IPR002515 | 765 | 795 | PF01530 | Zinc finger | |
IPR002515 | 813 | 843 | PF01530 | Zinc finger | |
IPR002515 | 866 | 896 | PF01530 | Zinc finger |
![]() |
---|
Primer_f | ACCCACCATAGGAAACAAGAC |
---|---|
Primer_r | TGAAGTGTGGATGAGTCTGTG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | ACCCACCATAGGAAACAAGAC |
Primer_r | TGAAGTGTGGATGAGTCTGTG |
PCR product length | 152 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |