Order Kazusa clone(s) from : ![]() |
Product ID | ORK01147 |
---|---|
Accession No | AB029029 |
Description | myelin transcription factor 1-like |
Clone name | fg01888 |
Vector information | |
cDNA sequence | DNA sequence (6953 bp) Predicted protein sequence (1154 aa) |
HaloTag ORF Clone |
FHC01147
![]() |
Flexi ORF Clone | FXC01147 |
Source | Human fetal brain |
Rouge ID |
mKIAA1106
by Kazusa Mouse cDNA Project
|
Note | We replaced hh02905, former representative clones for KIAA1106 with fg01888. (2001/5/29) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 2746 bp |
---|---|
Genome contig ID | gi89161199r_1671900 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 2 | r | 1771900 | 2314033 | 26 | 99.8 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR002515 | 50 | 80 | PF01530 | Zinc finger |
IPR002515 | 471 | 501 | PF01530 | Zinc finger | |
IPR002515 | 515 | 545 | PF01530 | Zinc finger | |
IPR013681 | 589 | 841 | PF08474 | Myelin transcription factor 1 | |
IPR002515 | 870 | 900 | PF01530 | Zinc finger | |
IPR002515 | 919 | 949 | PF01530 | Zinc finger | |
IPR002515 | 972 | 1002 | PF01530 | Zinc finger | |
ScanRegExp | IPR002048 | 800 | 812 | PS00018 | Calcium-binding EF-hand |
![]() |
Primer_f | ATGCATTTCCCCACCGCGTTG |
---|---|
Primer_r | CAACGTTAGATGAGCAGCAGG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | CCR |
---|---|
Primer_f | ATGCATTTCCCCACCGCGTTG |
Primer_r | CAACGTTAGATGAGCAGCAGG |
PCR product length | 157 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |