KIAA1106

Product ID	ORK01147
Accession No	AB029029
Description	myelin transcription factor 1-like
Clone name	fg01888
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6953 bp) Predicted protein sequence (1154 aa)
HaloTag ORF Clone	FHC01147
Flexi ORF Clone	FXC01147
Source	Human fetal brain
Rouge ID	mKIAA1106 by Kazusa Mouse cDNA Project
Note	We replaced hh02905, former representative clones for KIAA1106 with fg01888. (2001/5/29)

Length: 6953 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2746 bp
Genome contig ID	gi89161199r_1671900
PolyA signal sequence (None)	+--------+--------+----*----+---- ATAAACAAGGTGTTGCCACATTTGTAGCACGAAGG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATCTCTAACCCGGGTCTGCGTCTTCACTTGAGTCTGGGAAATGCTGTCTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	r	1771900	2314033	26	99.8	Perfect prediction

Length: 1154 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI50282	100.0	MYT1L protein [...	Homo sapiens
AAI37274	95.6	Myelin transcri...	Homo sapiens
XP_001096422	95.1	myelin transcri...	Macaca mulatta
Q9UL68	95.2	Myelin transcri...	Homo sapiens
AAF14051	95.1	myelin transcri...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020642	1.2e-95	48.4	KIAA0835
AB028973	5e-86	57.0	KIAA1050
AB011107	1.9e-72	43.0	KIAA0535

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002515	50	80	PF01530	Zinc finger
	IPR002515	471	501	PF01530	Zinc finger
	IPR002515	515	545	PF01530	Zinc finger
	IPR013681	589	841	PF08474	Myelin transcription factor 1
	IPR002515	870	900	PF01530	Zinc finger
	IPR002515	919	949	PF01530	Zinc finger
	IPR002515	972	1002	PF01530	Zinc finger
ScanRegExp	IPR002048	800	812	PS00018	Calcium-binding EF-hand

Primer_f	ATGCATTTCCCCACCGCGTTG
Primer_r	CAACGTTAGATGAGCAGCAGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	CCR
Primer_f	ATGCATTTCCCCACCGCGTTG
Primer_r	CAACGTTAGATGAGCAGCAGG
PCR product length	157 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles