Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK04050 |
---|---|
Accession No | AB028983 |
Description | adenylate cyclase 2 (brain) |
Clone name | hh13580 |
Vector information | |
cDNA sequence | DNA sequence (5873 bp) Predicted protein sequence (887 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA1060
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 3209 bp |
---|---|
Genome contig ID | gi51511721f_7579322 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (303874 - 303923) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 5 | f | 7679322 | 7883194 | 22 | 99.4 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001054 | 77 | 261 | PF00211 | Adenylyl cyclase class-3/4/guanylyl cyclase |
IPR009398 | 273 | 396 | PF06327 | Adenylate cyclase-like | |
IPR001054 | 674 | 874 | PF00211 | Adenylyl cyclase class-3/4/guanylyl cyclase | |
HMMSmart | IPR001054 | 31 | 239 | SM00044 | Adenylyl cyclase class-3/4/guanylyl cyclase |
IPR001054 | 643 | 857 | SM00044 | Adenylyl cyclase class-3/4/guanylyl cyclase | |
ProfileScan | IPR001054 | 86 | 213 | PS50125 | Adenylyl cyclase class-3/4/guanylyl cyclase |
IPR001054 | 683 | 828 | PS50125 | Adenylyl cyclase class-3/4/guanylyl cyclase | |
ScanRegExp | IPR001054 | 190 | 213 | PS00452 | Adenylyl cyclase class-3/4/guanylyl cyclase |
IPR001054 | 805 | 828 | PS00452 | Adenylyl cyclase class-3/4/guanylyl cyclase |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 399 | YVTCACLIFFCIFIVQILVLPKT | 421 | PRIMARY | 23 | 2 | 427 | SFGAAFLLLAFILFVCFAGQLLQ | 449 | PRIMARY | 23 | 3 | 475 | RISLTIITTAIILMMAVFNMFFL | 497 | PRIMARY | 23 | 4 | 531 | FFLPYFIYSCILGLISCSVFLRV | 553 | PRIMARY | 23 | 5 | 598 | LKTMGSVSLSIFFITLLVLGRQ | 619 | SECONDARY | 22 |
---|
RT-PCR-ELISA |
Primer_f | CGCTAGTGATTAAACGAGGCA |
---|---|
Primer_r | GTCATGCTCTACTCACACTTC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | UniGene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |