Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK04051 |
---|---|
Accession No | AB011083 |
Description | adenylate cyclase 3 |
Clone name | he00818 |
Vector information | |
cDNA sequence | DNA sequence (3563 bp) Predicted protein sequence (933 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA0511
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001054 | 99 | 283 | PF00211 | Adenylyl cyclase class-3/4/guanylyl cyclase |
IPR001054 | 703 | 910 | PF00211 | Adenylyl cyclase class-3/4/guanylyl cyclase | |
HMMSmart | IPR001054 | 59 | 261 | SM00044 | Adenylyl cyclase class-3/4/guanylyl cyclase |
IPR001054 | 672 | 891 | SM00044 | Adenylyl cyclase class-3/4/guanylyl cyclase | |
ProfileScan | IPR001054 | 108 | 235 | PS50125 | Adenylyl cyclase class-3/4/guanylyl cyclase |
IPR001054 | 712 | 864 | PS50125 | Adenylyl cyclase class-3/4/guanylyl cyclase | |
ScanRegExp | IPR001054 | 212 | 235 | PS00452 | Adenylyl cyclase class-3/4/guanylyl cyclase |
IPR001054 | 841 | 864 | PS00452 | Adenylyl cyclase class-3/4/guanylyl cyclase |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 12 | LREILANVFLYLCAIAVGIMSYY | 34 | PRIMARY | 23 | 2 | 425 | FSCSCVVLLCTALVEILIDPWLM | 447 | PRIMARY | 23 | 3 | 456 | GEILLLILTICSLAAIFPRAFP | 477 | PRIMARY | 22 | 4 | 497 | WAMLAIFILVMANVVDMLSCLQY | 519 | PRIMARY | 23 | 5 | 552 | IATIMLVQVSHMVKLTLMLLVAG | 574 | PRIMARY | 23 |
---|
RT-PCR |
---|
RT-PCR-ELISA |
Primer_f | ATGTGGTCCGAGTGAGGTGAG |
---|---|
Primer_r | TCTGTTCTCATGACTAAGGGG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | ATGTGGTCCGAGTGAGGTGAG |
Primer_r | TCTGTTCTCATGACTAAGGGG |
PCR product length | 98 bp |
PCR conditions | 95 °C15 sec64 °C60 sec30 cycles |