KIAA1093

Product ID	ORK00738
Accession No	AB029016
Description	trinucleotide repeat containing 6B, transcript variant 2
Clone name	fh18956
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5479 bp) Predicted protein sequence (1727 aa)
HaloTag ORF Clone	FHC00738
Flexi ORF Clone	FXC00738
Source	Human fetal brain
Rouge ID	mKIAA1093 by Kazusa Mouse cDNA Project
Note	We replaced hk06357, former representative clones for KIAA1093 with fh18956. (2001/5/29)

Length: 5479 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	Warning

Integrity of 3' end

Length of 3'UTR	116 bp
Genome contig ID	gi89161203f_38803925
PolyA signal sequence (AATAAA,-28)	+--------+--------+----*----+---- AACTTGCAATAAATACATTTTTAAAAGGAAAAAAG
Flanking genome sequence (245383 - 245432)	----+--------+--------+--------+--------+----* AAAACGGAGAGAAAAAAAGGTGGGTCATTGACAGACTGTCTGAGCACATA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	22	f	38903892	39049306	21	99.8	Perfect prediction

Length: 1727 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG09966	100.0	trinucleotide r...	synthetic construct
Q9UPQ9	99.9	Trinucleotide r...	Homo sapiens
EAW60373	99.9	trinucleotide r...	Homo sapiens
XP_001101111	99.4	trinucleotide r...	Macaca mulatta
XP_859340	97.2	similar to Trin...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040893	4.4e-45	38.9	KIAA1460
AB046802	3.1e-22	36.2	KIAA1582

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Primer_f	CCTAGAAAGACAATGTGAAGC
Primer_r	GACCTAAGGACGGAAACACAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CAGAACCAGTCAGATCCCGTG
Primer_r	ATGAAGCGCCAGCAAGATCGG
PCR product length	118 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles