KIAA1582

Product ID	ORK00249
Accession No	AB046802
Description	trinucleotide repeat containing 6C, transcript variant 2
Clone name	fj05982s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5318 bp) Predicted protein sequence (1740 aa)
HaloTag ORF Clone	FHC00249
Flexi ORF Clone	FXC00249
Source	Human fetal brain
Rouge ID	mKIAA1582 by Kazusa Mouse cDNA Project
Note	We replaced fj05982, former representative clones for KIAA1582 with fj05982s1. (2002/5/10)

Length: 5318 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	95 bp
Genome contig ID	gi51511734f_73456589
PolyA signal sequence (None)	+--------+--------+----*----+---- GCCCCACAGACCCGCTGGAACCCAGCAGCGGCCGC
Flanking genome sequence (156029 - 156078)	----+--------+--------+--------+--------+----* CCTTTTGAGTACCTCTGTCCAGGACTGAAGACGAACCTTGGCCGCAGTCC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	f	73556589	73612616	18	99.4	Perfect prediction

Length: 1740 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9HCJ0	100.0	Trinucleotide r...	Homo sapiens
EAW89483	99.8	trinucleotide r...	Homo sapiens
CAX15807	90.9	trinucleotide r...	Mus musculus
BAE27937	90.5	unnamed protein...	Mus musculus
CAM27640	90.5	trinucleotide r...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040893	1.8e-50	45.4	KIAA1460
AB029016	5.3e-23	36.1	KIAA1093

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000449	989	1028	PF00627	Ubiquitin-associated/Translation elongation factor EF1B
HMMPfam	IPR000504	1566	1631	PF00076	RNA recognition motif
HMMSmart	IPR000449	990	1027	SM00165	Ubiquitin-associated/Translation elongation factor EF1B
ProfileScan	IPR000449	983	1028	PS50030	Ubiquitin-associated/Translation elongation factor EF1B

Primer_f	CTGCTGGAAAAGAAGGTGGAC
Primer_r	GAAGGCAAGAACGGTGAAGGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	CCR
Primer_f	CTGCTGGTCCTGGAATACTCG
Primer_r	CCTTTCCCATTGATGTCACTG
PCR product length	169 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles