Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK05638 |
---|---|
Accession No | AB032974 |
Description | tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2 |
Clone name | bg00390 |
Vector information | |
cDNA sequence | DNA sequence (7384 bp) Predicted protein sequence (543 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA1148
by Kazusa Mouse cDNA Project
|
Note | We replaced hg00436, former representative clones for KIAA1148 with bg00390. (2002/12/27) Please refer to "Gene/Protein Characteristic Table for KIAA1636" because the cDNA sequence of KIAA1148 is included in KIAA1636. |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 5750 bp |
---|---|
Genome contig ID | gi51511734f_58751415 |
PolyA signal sequence (TATAAA,-26) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (107385 - 107434) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 17 | f | 58851415 | 58858798 | 1 | 100.0 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
RT-PCR-ELISA |
Primer_f | ATCTCCACTTCATTCACAGGT |
---|---|
Primer_r | CAAAGATGCTGTGCTAGATGG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |