KIAA1636

Product ID	ORK07058
Accession No	AB046856
Description	tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2
Clone name	ff02660
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (11341 bp) Predicted protein sequence (1864 aa)
Source	Human fetal brain
Note	We replaced fh23458, former representative clones for KIAA1636 with ff02660. (2003/4/2)

Length: 11341 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	5744 bp
Genome contig ID	gi51511734f_58531880
PolyA signal sequence (TATAAA,-20)	+--------+--------+----*----+---- GCAAATGTACTTATTTATAAATGGCTAACACTTGG
Flanking genome sequence (326914 - 326963)	----+--------+--------+--------+--------+----* AAAACCATGGTGTTGTGATGCTTTTCTCCTTCCATTACAGCCTCTTCAGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	f	58631880	58858792	21	99.3	Perfect prediction

Length: 1864 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9HCD6	100.0	Protein TANC2; ...	Homo sapiens
XP_001116098	99.6	similar to TPR ...	Macaca mulatta
XP_511597	99.6	tetratricopepti...	Pan troglodytes
XP_001501350	98.7	tetratricopepti...	Equus caballus
XP_850197	98.6	similar to TPR ...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051515	6.2e-127	52.4	KIAA1728
AB032974	1e-83	100.0	KIAA1148
AB033049	6.8e-08	25.7	KIAA1223
AB033076	0.00024	29.7	KIAA1250
AB014597	0.00042	32.0	KIAA0697

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002110	974	986	PR01415	Ankyrin
FPrintScan	IPR002110	1019	1031	PR01415	Ankyrin
HMMPfam	IPR002110	726	755	PF00023	Ankyrin
	IPR002110	767	790	PF00023	Ankyrin
	IPR002110	791	823	PF00023	Ankyrin
	IPR002110	824	847	PF00023	Ankyrin
	IPR002110	868	886	PF00023	Ankyrin
	IPR002110	907	939	PF00023	Ankyrin
	IPR002110	940	972	PF00023	Ankyrin
	IPR002110	973	1005	PF00023	Ankyrin
	IPR002110	1006	1038	PF00023	Ankyrin
	IPR002110	1039	1071	PF00023	Ankyrin
	IPR002110	1072	1104	PF00023	Ankyrin
	IPR001440	1165	1198	PF00515	Tetratricopeptide TPR_1
	IPR001440	1199	1232	PF00515	Tetratricopeptide TPR_1
HMMSmart	IPR002110	720	752	SM00248	Ankyrin
	IPR002110	756	787	SM00248	Ankyrin
	IPR002110	791	820	SM00248	Ankyrin
	IPR002110	824	853	SM00248	Ankyrin
	IPR002110	864	892	SM00248	Ankyrin
	IPR002110	907	936	SM00248	Ankyrin
	IPR002110	940	969	SM00248	Ankyrin
	IPR002110	973	1002	SM00248	Ankyrin
	IPR002110	1006	1035	SM00248	Ankyrin
	IPR002110	1039	1068	SM00248	Ankyrin
	IPR002110	1072	1101	SM00248	Ankyrin
	IPR013026	1118	1151	SM00028	Tetratricopeptide region
	IPR013026	1165	1198	SM00028	Tetratricopeptide region
	IPR013026	1199	1232	SM00028	Tetratricopeptide region
ProfileScan	IPR002110	736	1099	PS50297	Ankyrin
	IPR002110	791	823	PS50088	Ankyrin
	IPR002110	907	939	PS50088	Ankyrin
	IPR002110	940	972	PS50088	Ankyrin
	IPR002110	973	1005	PS50088	Ankyrin
	IPR002110	1006	1038	PS50088	Ankyrin
	IPR002110	1039	1071	PS50088	Ankyrin
	IPR013026	1118	1151	PS50005	Tetratricopeptide region
	IPR013026	1118	1232	PS50293	Tetratricopeptide region
	IPR013026	1165	1198	PS50005	Tetratricopeptide region
	IPR013026	1199	1232	PS50005	Tetratricopeptide region

Primer_f	CTACGAATGCCAAGACAGAGC
Primer_r	AGTTGAGCATCTATTTCGTGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-