KIAA1180

Product ID	ORK01154
Accession No	AB033006
Description	NDRG family member 4, transcript variant 6
Clone name	hf00665as1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (2994 bp) Predicted protein sequence (360 aa)
HaloTag ORF Clone	FHC01154
Flexi ORF Clone	FXC01154
Source	Human adult brain
Rouge ID	mKIAA1180 by Kazusa Mouse cDNA Project
Note	We replaced hf00665a, former representative clones for KIAA1180 with hf00665as1. (2002/5/10)

Length: 2994 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1843 bp
Genome contig ID	gi51511732f_56991562
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- AACTGTGCTGAAAAACTAATAAAGAACCTAAGAAG
Flanking genome sequence (113258 - 113307)	----+--------+--------+--------+--------+----* AATTCCAGTGTGGTGATGCCATGCCCATCATGGGAGGCTTTTGGAGAAAC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	16	f	57091562	57104818	15	99.3	Perfect prediction

Length: 360 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9ULP0	1.5e-148	100.0	Protein NDRG4; ...	Homo sapiens
Q8BTG7	7.5e-146	97.7	Protein NDRG4; ...	Mus musculus
EDL87274	6.3e-145	97.2	N-myc downstrea...	Rattus norvegicus
Q9Z2L9	1.2e-144	96.9	Protein NDRG4; ...	Rattus norvegicus
AAO65544	2.5e-140	96.3	brain and heart...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB033074	6e-79	62.0	KIAA1248

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004142	16	298	PF03096	Ndr

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	120	GVGAGAYVLAKFALIFPDLVEGL	142	PRIMARY	23

Primer_f	GGACGCATCACTAAGGAAGAG
Primer_r	AAGCATACAACGCAGTCCTGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-