KIAA1201

Product ID	ORK00764
Accession No	AB033027
Description	GRAM domain containing 1B, transcript variant 3
Clone name	fg03153
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6225 bp) Predicted protein sequence (761 aa)
HaloTag ORF Clone	FHC00764
Flexi ORF Clone	FXC00764
Source	Human fetal brain
Rouge ID	mKIAA1201 by Kazusa Mouse cDNA Project

Length: 6225 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	3832 bp
Genome contig ID	gi51511727f_122836247
PolyA signal sequence (AATGAA,-18)	+--------+--------+----*----+---- AACTATACCTTCTGCATAATGAATTAACTAGAAAT
Flanking genome sequence	None

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	11	f	122936247	123002319	19	99.2	Terminal No-hit

Length: 761 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q3KR37	100.0	GRAM domain-con...	Homo sapiens
XP_001108370	99.5	similar to CG33...	Macaca mulatta
BAG54507	98.9	unnamed protein...	Homo sapiens
XP_001503463	98.9	similar to GRAM...	Equus caballus
AAH70451	97.3	Gramd1b protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040966	1.2e-75	47.5	KIAA1533
AB020689	1.3e-05	35.7	KIAA0882
AB014576	0.00051	33.9	KIAA0676

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004182	119	186	PF02893	GRAM
HMMSmart	IPR004182	119	186	SM00568	GRAM

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	646	LLLVISCVICFSLVLLVILNMML	668	PRIMARY	23

Primer_f	AACGGAGAGCACTTATTTGGC
Primer_r	CCTGCCACATGTTTGATCCTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	AACGGAGAGCACTTATTTGGC
Primer_r	CCTGCCACATGTTTGATCCTG
PCR product length	189 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles