KIAA1218

Gene/Protein Characteristic Table for KIAA1218

Order Kazusa clone(s) from :

Product ID	ORK00771
Accession No	AB033044
Description	ataxin 7-like 1
Clone name	fh03016
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5410 bp) Predicted protein sequence (864 aa)
HaloTag ORF Clone	FHC00771
Flexi ORF Clone	FXC00771
Source	Human fetal brain

Features of the cloned cDNA sequence

Description

Length: 5410 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2784 bp
Genome contig ID	gi89161213r_104932750
PolyA signal sequence (None)	+--------+--------+----*----+---- TGAAGCATAACGCAATGCATAGACCTGTCAGCCAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAAAAAGCGACTTGGATAACTTGTATGCCTTC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	7	r	105032750	105311027	12	99.4	Internal No-hit

Features of the protein sequence

Description

Length: 864 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
NP_065776	99.9	ataxin 7-like 1...	Homo sapiens
XP_519298	99.3	ataxin 7-like 1...	Pan troglodytes
Q9ULK2	100.0	Ataxin-7-like p...	Homo sapiens
XP_001162005	99.5	ataxin 7-like 1...	Pan troglodytes
XP_001087162	97.4	hypothetical pr...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013243	273	350	PF08313	SCA7

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	GTGATGTCCTCTGGGTCCTTC
Primer_r	CTCTATGGCTGGCGACAAGTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 7

Experimental conditions

Panel name	GeneBridge 4
Primer_f	GTGATGTCCTCTGGGTCCTTC
Primer_r	CTCTATGGCTGGCGACAAGTC
PCR product length	116 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp