Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK05357 |
---|---|
Accession No | AB033046 |
Description | glutamate receptor, ionotropic, delta 1 |
Clone name | fh03489 |
Vector information | |
cDNA sequence | DNA sequence (5097 bp) Predicted protein sequence (791 aa) |
Source | Human fetal brain |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 2719 bp |
---|---|
Genome contig ID | gi89161187r_87249292 |
PolyA signal sequence (ATTAAA,-19) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 10 | r | 87349292 | 87888629 | 12 | 99.4 | Internal No-hit |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | NULL | 409 | 474 | PD245531 | NULL |
FPrintScan | IPR001508 | 262 | 290 | PR00177 | NMDA receptor |
IPR001508 | 347 | 372 | PR00177 | NMDA receptor | |
IPR001508 | 414 | 441 | PR00177 | NMDA receptor | |
IPR001508 | 613 | 637 | PR00177 | NMDA receptor | |
HMMPfam | IPR001828 | 1 | 183 | PF01094 | Extracellular ligand-binding receptor |
IPR001638 | 245 | 329 | PF00497 | Bacterial extracellular solute-binding protein | |
IPR001320 | 344 | 634 | PF00060 | Ionotropic glutamate receptor | |
HMMSmart | IPR001320 | 220 | 589 | SM00079 | Ionotropic glutamate receptor |
ScanRegExp | IPR002086 | 685 | 692 | PS00687 | Aldehyde dehydrogenase |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 340 | FAPFDFAVWACIAAAIPVVGVLI | 362 | PRIMARY | 23 | 2 | 382 | SASATLHSAIWIVYGAFVQQGGE | 404 | SECONDARY | 23 | 3 | 413 | RIVMGSWWLFTLIVCSSYTANLA | 435 | SECONDARY | 23 | 4 | 612 | SFAGVFCILAIGLLLACLVAALE | 634 | PRIMARY | 23 |
---|
RT-PCR-ELISA |
Primer_f | ATCAAACTCTGGTCTCACTGC |
---|---|
Primer_r | GAAGACATCCAAGCTATACCC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | ATCAAACTCTGGTCTCACTGC |
Primer_r | GAAGACATCCAAGCTATACCC |
PCR product length | 97 bp |
PCR conditions | 95 °C15 sec62 °C60 sec30 cycles |