KIAA1235

Gene/Protein Characteristic Table for KIAA1235

Order Kazusa clone(s) from :

Product ID	ORK04168
Accession No	AB033061
Description	AT rich interactive domain 1B (SWI1-like)
Clone name	fh08704
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5834 bp) Predicted protein sequence (1485 aa)
Source	Human fetal brain
Rouge ID	mKIAA1235 by Kazusa Mouse cDNA Project

Length: 5834 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1376 bp
Genome contig ID	gi89161210f_157395934
PolyA signal sequence (AATAAA,-34)	+--------+--------+----*----+---- GAATAAATGTACATTAAATCTTGTTAAGCACTGTG
Flanking genome sequence (176161 - 176210)	----+--------+--------+--------+--------+----* ATGGGTGTTCTTGAATACTGTTCTAGTTTCCTTAAAGTGGTTTCCTAGTA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	6	f	157495934	157572093	14	99.9	Perfect prediction

Features of the protein sequence

Description

Length: 1485 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAI42305	99.9	novel protein [...	Homo sapiens
EAW47678	99.9	AT rich interac...	Homo sapiens
XP_001133842	99.9	hypothetical pr...	Homo sapiens
EDL01654	94.3	mCG5693 [Mus mu...	Mus musculus
NP_001078824	94.3	AT rich interac...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001606	299	404	PF01388	AT-rich interaction region
HMMSmart	IPR001606	303	394	SM00501	AT-rich interaction region
ProfileScan	IPR001606	302	393	PS51011	AT-rich interaction region

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	GAGGTATGTCGGTCAGTAGTC
Primer_r	CGTTGTCAGGTATGTATTCTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 6

Experimental conditions

Panel name	GeneBridge 4
Primer_f	GAGGTATGTCGGTCAGTAGTC
Primer_r	CGTTGTCAGGTATGTATTCTC
PCR product length	122 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp