KIAA1243

Product ID	ORK06001
Accession No	AB033069
Description	MKL/myocardin-like 2
Clone name	pf00817
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (7815 bp) Predicted protein sequence (828 aa)
Source	Human brain (hippocampus)
Rouge ID	mKIAA1243 by Kazusa Mouse cDNA Project
Note	We replaced he00844, former representative clones for KIAA1243 with pf00817. (2002/5/10)

Length: 7815 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	5328 bp
Genome contig ID	gi51511732f_14141593
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- CATTTTTGTGTCTCAAATAAAAGACATTTTGATGT
Flanking genome sequence (126539 - 126588)	----+--------+--------+--------+--------+----* ACTATGATTCTTGCTGTGCAGAGGAAAGACCACTCCCTATGGGTTGGTGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	16	f	14235624	14268130	9	99.2	Perfect prediction

Length: 828 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9ULH7	100.0	MKL/myocardin-l...	Homo sapiens
EAW85112	100.0	MKL/myocardin-l...	Homo sapiens
XP_001146854	97.1	megakaryoblasti...	Pan troglodytes
XP_001146728	97.1	megakaryoblasti...	Pan troglodytes
XP_547119	87.3	similar to MKL/...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037859	3.5e-10	38.4	KIAA1438

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003034	129	163	PF02037	DNA-binding SAP
HMMSmart	IPR003034	129	163	SM00513	DNA-binding SAP
ProfileScan	IPR003034	129	163	PS50800	DNA-binding SAP

Primer_f	ACAGAGCTTTATGCCAACTAC
Primer_r	TTCCTAAATGCTTCCTCTTCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	ACAGAGCTTTATGCCAACTAC
Primer_r	TTCCTAAATGCTTCCTCTTCC
PCR product length	134 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles