KIAA1438

Product ID	ORK00835
Accession No	AB037859
Description	megakaryoblastic leukemia (translocation) 1, transcript variant 1
Clone name	hk07374s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4494 bp) Predicted protein sequence (1075 aa)
HaloTag ORF Clone	FHC00835
Flexi ORF Clone	FXC00835
Source	Human adult brain
Note	We replaced hk07374, former representative clones for KIAA1438 with hk07374s1. (2002/5/10)

Length: 4494 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1101 bp
Genome contig ID	gi89161203r_39036239
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TGTGTGAACTTTTTAAAATAAACACAAAAACACAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* GCCTGTTAGTCCATCTTATTCAGTCCATGGAAGGGGTGGGTAGCACAGCT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	22	r	39136239	39362641	15	99.6	Perfect prediction

Length: 1075 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_849562	90.6	similar to mega...	Canis lupus fam...
CAC38828	100.0	OTT-MAL [Homo s...	Homo sapiens
XP_859184	89.1	similar to mega...	Canis lupus fam...
Q969V6	100.0	MKL/myocardin-l...	Homo sapiens
CAG30408	99.9	MKL1 [Homo sapi...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB033069	4.1e-09	38.3	KIAA1243

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003034	491	525	PF02037	DNA-binding SAP
HMMSmart	IPR004018	124	149	SM00707	RPEL repeat
	IPR004018	168	193	SM00707	RPEL repeat
	IPR004018	212	237	SM00707	RPEL repeat
	IPR003034	491	525	SM00513	DNA-binding SAP
ProfileScan	IPR004018	124	149	PS51073	RPEL repeat
	IPR004018	168	193	PS51073	RPEL repeat
	IPR004018	212	237	PS51073	RPEL repeat
	IPR003034	491	525	PS50800	DNA-binding SAP

Primer_f	CCCTGCCATTTTAGTGTCTTG
Primer_r	AGTAGGATGGGAGGGAGTTGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CCCTGCCATTTTAGTGTCTTG
Primer_r	AGTAGGATGGGAGGGAGTTGC
PCR product length	159 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles