KIAA1245

Product ID	ORK00778
Accession No	AB033071
Description	neuroblastoma breakpoint family, member 12
Clone name	hg04073
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6896 bp) Predicted protein sequence (892 aa)
Source	Human adult brain

Length: 6896 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	Warning

Integrity of 3' end

Length of 3'UTR	0 bp
Genome contig ID	gi89161185f_143213012
PolyA signal sequence (AAGAAA,-23)	+--------+--------+----*----+---- AAGGGGAAGGGGAAGAAAAGAAGGGGAAGAAGATC
Flanking genome sequence (862958 - 863007)	----+--------+--------+--------+--------+----* AAAGAAGGAAAGAAGAAGGGGAAGAAAAGAAGGGGAAGAAGATCAAAACC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	f	143309862	144075968	54	96.8	Terminal No-hit
Ensembl gnome browser	1	r	146042726	146082596	26	98.7	Both No-hit
Ensembl gnome browser	1	f	146827464	147023143	27	96.6	Both No-hit

Length: 892 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAG10008	0	100.0	neuroblastoma b...	synthetic construct
Q3BBV0	0	95.2	Neuroblastoma b...	Homo sapiens
Q86T75	2.8e-189	97.3	Neuroblastoma b...	Homo sapiens
A6NDD8	5.8e-189	97.2	Neuroblastoma b...	Homo sapiens
BAH13700	5.6e-181	97.2	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051480	2.3e-100	94.1	KIAA1693
AB007923	0.00037	22.7	KIAA0454

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR010630	200	266	PF06758	Protein of unknown function DUF1220
	IPR010630	471	537	PF06758	Protein of unknown function DUF1220
	IPR010630	745	807	PF06758	Protein of unknown function DUF1220
	IPR010630	831	892	PF06758	Protein of unknown function DUF1220

Primer_f	TCATTGTCTTCTTCAGGTGGC
Primer_r	GTAACCGTCTTGATCCATAGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CCATCACTTGTTCAAATAGCC
Primer_r	GAGAGGATGAGCCAATGAGAG
PCR product length	114 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles