Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK00781 |
---|---|
Accession No | AB033078 |
Description | sphingosine-1-phosphate lyase 1 |
Clone name | hh09572 |
Vector information | |
cDNA sequence | DNA sequence (5741 bp) Predicted protein sequence (580 aa) |
HaloTag ORF Clone |
FHC00781
|
Flexi ORF Clone | FXC00781 |
Source | Human adult brain |
Rouge ID |
mKIAA1252
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 3834 bp |
---|---|
Genome contig ID | gi89161187f_72145732 |
PolyA signal sequence (AATAAA,-19) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (165206 - 165255) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 10 | f | 72245732 | 72310936 | 15 | 99.3 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR002129 | 155 | 468 | PF00282 | Pyridoxal phosphate-dependent decarboxylase |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 51 | PWQLIAWSVVWTLLIVWGYEFVF | 73 | PRIMARY | 23 |
---|
RT-PCR-ELISA |
Primer_f | TCTGCATCACATTACTACACG |
---|---|
Primer_r | TTCTGCAACCATATTCCTGTC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |