KIAA1263

Product ID	ORK00787
Accession No	AB033089
Description	follistatin-like 5, transcript variant 2
Clone name	hj00608
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4755 bp) Predicted protein sequence (850 aa)
HaloTag ORF Clone	FHC00787
Flexi ORF Clone	FXC00787
Source	Human adult brain
Rouge ID	mKIAA1263 by Kazusa Mouse cDNA Project

Length: 4755 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1848 bp
Genome contig ID	gi89161207r_162424501
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TGCTTGATAAAAGGAGAATAAACCTCTTACATTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACCCTTGAGAGTTCAGTCAATGATTTAATATGCATACCGTTTTTAAAAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	4	r	162524501	163304568	16	99.9	Perfect prediction

Length: 850 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG10017	100.0	follistatin-rel...	synthetic construct
Q8N475	99.9	Follistatin-rel...	Homo sapiens
AAH36502	99.6	Follistatin-lik...	Homo sapiens
XP_001097841	97.8	follistatin-lik...	Macaca mulatta
XP_517513	96.0	follistatin-lik...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB028984	2.1e-158	60.3	KIAA1061
AB002341	2.2e-08	29.2	KIAA0343
AB040947	7.3e-08	24.3	KIAA1514
AB032958	1.8e-07	29.5	KIAA1132
AB046788	2.8e-07	30.1	KIAA1568

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002350	92	136	PF00050	Proteinase inhibitor I1
	IPR002048	182	210	PF00036	Calcium-binding EF-hand
	IPR013151	266	326	PF00047	Immunoglobulin
	IPR013098	344	433	PF07679	Immunoglobulin I-set
HMMSmart	IPR002350	91	136	SM00280	Proteinase inhibitor I1
	IPR003599	258	343	SM00409	Immunoglobulin subtype
	IPR003598	264	331	SM00408	Immunoglobulin subtype 2
	IPR003599	350	434	SM00409	Immunoglobulin subtype
	IPR003598	356	423	SM00408	Immunoglobulin subtype 2
ProfileScan	IPR002048	178	213	PS50222	Calcium-binding EF-hand
	IPR007110	253	326	PS50835	Immunoglobulin-like
	IPR007110	344	429	PS50835	Immunoglobulin-like
ScanRegExp	IPR002048	191	203	PS00018	Calcium-binding EF-hand
ScanRegExp	IPR002048	229	241	PS00018	Calcium-binding EF-hand

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	1	KAIRMFKCWSVVLVLGFIFLES	22	PRIMARY	22

Primer_f	AGGAAATGAGAAGGCCAGCAG
Primer_r	TGGAGGTCATTTCAACAGCCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	AGGAAATGAGAAGGCCAGCAG
Primer_r	TGGAGGTCATTTCAACAGCCC
PCR product length	172 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles