KIAA1264

Product ID	ORK00788
Accession No	AB033090
Description	p21 (RAC1) activated kinase 5 (PAK5), transcript variant 1
Clone name	hj01058
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4777 bp) Predicted protein sequence (753 aa)
HaloTag ORF Clone	FHC00788
Flexi ORF Clone	FXC00788
Source	Human adult brain

Length: 4777 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2070 bp
Genome contig ID	gi51511747r_9366038
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- ACTGCATTTGCAAATAAAAATAAATGTTTGCCTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TCCCCATTGTGTTATTGGAAACAGTGATTTCTCAAATTTATTTTATTGAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	20	r	9466038	9767689	11	99.5	Perfect prediction

Length: 753 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_525261	99.6	p21-activated k...	Pan troglodytes
XP_001113709	99.2	p21-activated k...	Macaca mulatta
Q9P286	100.0	Serine/threonin...	Homo sapiens
BAF84090	99.9	unnamed protein...	Homo sapiens
BAF98711	99.9	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB032968	1.1e-58	65.6	KIAA1142
D86959	4.9e-18	34.8	KIAA0204
AB037782	1.5e-16	35.9	KIAA1361
AB020688	2.8e-16	35.9	KIAA0881
AB011123	1.3e-15	38.9	KIAA0551

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	488	733	PD000001	Protein kinase
HMMPfam	IPR000095	44	101	PF00786	PAK-box/P21-Rho-binding
HMMPfam	IPR000719	483	734	PF00069	Protein kinase
HMMSmart	IPR000095	45	80	SM00285	PAK-box/P21-Rho-binding
	IPR001245	483	734	SM00219	Tyrosine protein kinase
	IPR002290	483	734	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000095	45	58	PS50108	PAK-box/P21-Rho-binding
ProfileScan	IPR000719	483	734	PS50011	Protein kinase
ScanRegExp	IPR000719	489	513	PS00107	Protein kinase

Primer_f	ATGTATCGTGCTGGAAGTCTG
Primer_r	AACATGGGCACAACTGAAGTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	ATGTATCGTGCTGGAAGTCTG
Primer_r	AACATGGGCACAACTGAAGTC
PCR product length	94 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles