KIAA1276

Product ID	ORK00793
Accession No	AB033102
Description	family with sequence similarity 184, member B
Clone name	fh00139s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pYO326 vector. The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. pYO326 shuttle vector, pYO326 (Amp-r) was kindly provided by Y. Ohya (University of Tokyo).
cDNA sequence	DNA sequence (3653 bp) Predicted protein sequence (1068 aa)
HaloTag ORF Clone	FHC00793
Flexi ORF Clone	FXC00793
Source	Human fetal brain
Note	We replaced fh00139, former representative clones for KIAA1276 with fh00139s1. (2002/5/10)

Length: 3653 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	444 bp
Genome contig ID	gi89161207r_17143095
PolyA signal sequence (None)	+--------+--------+----*----+---- AACCAGCCTGGGTGACAGAGGGAGACCCTGTCTCC
Flanking genome sequence (99714 - 99665)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAATTGACA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	4	r	17242809	17392046	18	99.5	Perfect prediction

Length: 1068 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9ULE4	99.7	Protein FAM184B.	Homo sapiens
NP_056503	99.6	hypothetical pr...	Homo sapiens
XP_001118953	93.7	similar to [Seg...	Macaca mulatta
XP_536227	84.6	similar to Myos...	Canis lupus fam...
XP_602183	82.7	similar to hCG4...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037740	1.6e-05	23.3	KIAA1319
AB023217	3.6e-05	22.0	KIAA1000
AB007914	0.0001	24.2	KIAA0445
D13629	0.00015	22.3	KIAA0004
AB046785	0.00016	22.4	KIAA1565

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Primer_f	CTTTCTGAGTGGCGATCTGAG
Primer_r	TAGACTGGTTGGGTTTGTAGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CTTTCTGAGTGGCGATCTGAG
Primer_r	TAGACTGGTTGGGTTTGTAGG
PCR product length	110 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles