KIAA1305

Product ID	ORK05651
Accession No	AB037726
Description	NYN domain and retroviral integrase containing
Clone name	fh04045s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (7296 bp) Predicted protein sequence (1819 aa)
Source	Human fetal brain
Rouge ID	mKIAA1305 by Kazusa Mouse cDNA Project
Note	We replaced fh04045, former representative clones for KIAA1305 with fh04045s1. (2002/5/10)

Length: 7296 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1836 bp
Genome contig ID	gi51511730f_23846954
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TTTCATTTGATTTGTCAATAAACGAATCAAACTGG
Flanking genome sequence (111376 - 111425)	----+--------+--------+--------+--------+----* AGCTGATGTCCAGTTCTTTGTTTAGCTTCAGTCTCAATTGTGGGAATGAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	14	f	23946954	23958328	7	99.4	Perfect prediction

Length: 1819 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001056534	75.3	similar to CG10...	Rattus norvegicus
EAW66019	100.0	hCG40187, isofo...	Homo sapiens
XP_001104789	95.3	similar to CG10...	Macaca mulatta
XP_547747	84.8	similar to CG10...	Canis lupus fam...
XP_001476349	75.1	hypothetical pr...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002321	1.2e-19	62.6	KIAA0323
AB014515	2.3e-14	49.5	KIAA0615
AB051513	4e-08	46.9	KIAA1726

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001584	1530	1598	PF00665	Integrase
ProfileScan	IPR001584	1530	1651	PS50994	Integrase

Primer_f	ACCTCCACTGTATCCTGCATC
Primer_r	AACTCACACTCACTGCAAGGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-