Gene/Protein Characteristic Table for KIAA0615
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00576
Accession No AB014515
Description NEDD4 binding protein 1
Clone name hg01354a
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (3319 bp)
Predicted protein sequence (943 aa)
Flexi ORF Clone FXC00576
Source Human adult brain
Rouge ID mKIAA0615 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 3319 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Features of the protein sequence
Description

Length: 943 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
XP_520627 0 99.4 Nedd4 binding p...
Pan troglodytes
XP_001109863 0 97.9 Nedd4 binding p...
Macaca mulatta
O75113 0 100.0 NEDD4-binding p...
Homo sapiens
AAI60019 0 99.9 NEDD4 binding p...
synthetic construct
AAI08289 0 99.9 N4BP1 protein [...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB002321 1.6e-29 30.4 KIAA0323
AB037726 2.8e-24 49.5 KIAA1305
AB051513 3.1e-17 50.7 KIAA1726
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile
Description

RT-PCR
RT-PCR-ELISA
Experimental conditions
Primer_f CCCACCCATACATGAAAGATC
Primer_r CATTCCCATCAGGTACAGGTG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 16
Experimental conditions
Panel name GeneBridge 4
Primer_f CCCACCCATACATGAAAGATC
Primer_r CATTCCCATCAGGTACAGGTG
PCR product length 130 bp
PCR conditions 95 °C15 sec64 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp