KIAA1333

Product ID	ORK00216
Accession No	AB037754
Description	G2/M-phase specific E3 ubiquitin protein ligase, transcript variant 1
Clone name	fh15412
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5534 bp) Predicted protein sequence (741 aa)
HaloTag ORF Clone	FHC00216
Flexi ORF Clone	FXC00216
Source	Human fetal brain
Rouge ID	mKIAA1333 by Kazusa Mouse cDNA Project

Length: 5534 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	3307 bp
Genome contig ID	gi51511730f_29998128
PolyA signal sequence (AATAAA,-27)	+--------+--------+----*----+---- TATAAATAAATAAATGTGTTTATGCCACTAAAGGT
Flanking genome sequence (160671 - 160720)	----+--------+--------+--------+--------+----* AAACTGCCTATTTAAACTAAGTAATTTTTTGGGATTTAATAAGATTAAGA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	14	f	30098128	30158797	15	99.4	Perfect prediction

Length: 741 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAA91095	99.7	unnamed protein...	Homo sapiens
Q4R9C4	98.0	G2/M phase-spec...	Macaca fascicularis
BAE00297	97.9	unnamed protein...	Macaca fascicularis
BAE00975	97.7	unnamed protein...	Macaca fascicularis
BAG59435	99.8	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB058726	9e-12	31.4	KIAA1823
AB002302	4.3e-06	26.1	KIAA0304
AB006630	2.9e-05	33.3	KIAA0292

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000569	449	729	PF00632	HECT
HMMSmart	IPR001965	115	163	SM00249	Zinc finger
	IPR001965	178	228	SM00249	Zinc finger
	IPR000569	408	729	SM00119	HECT
ProfileScan	IPR000569	564	727	PS50237	HECT
ScanRegExp	IPR001965	116	182	PS01359	Zinc finger

Primer_f	TTTGGAACAGTTACTTACAGG
Primer_r	AAAATCCACATGCAGACACTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-