Gene/Protein Characteristic Table for KIAA1823
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00927
Accession No AB058726
Description PHD finger protein 6, transcript variant 2
Clone name fj18328
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4315 bp)
Predicted protein sequence (377 aa)
Flexi ORF Clone FXC00927
Source Human fetal brain
Rouge ID mKIAA1823 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4315 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Integrity of 3' end
Length of 3'UTR 3129 bp
Genome contig ID gi89161218f_133235122
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
TATACTATTCATTCAATAAATGACTTATGACTTTC
Flanking genome sequence
(155365 - 155414)
----+----*----+----*----+----*----+----*----+----*
ATATTTGTTTGTCTTTTTTGTGAAAGTGTATACTGAAGCTTATTTGATAA
Features of the protein sequence
Description

Length: 377 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q8IWS0 1.2e-150 100.0 PHD finger prot...
Homo sapiens
Q08DR0 2.2e-150 99.7 PHD finger prot...
Bos taurus
XP_852628 2.2e-150 99.7 similar to PHD ...
Canis lupus fam...
XP_866100 1.2e-149 99.5 similar to PHD ...
Canis lupus fam...
XP_001927436 1.7e-149 99.5 similar to PHD ...
Sus scrofa
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB037754 1.8e-09 31.4 KIAA1333
AB002302 3.9e-05 25.0 KIAA0304
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMSmart IPR001965 93 144 SM00249 Zinc finger
IPR001965 291 342 SM00249 Zinc finger
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f GGTTGGCTAGATAAGTGGCTG
Primer_r CTACCCAGAAGATGATGATGC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. X
Experimental conditions
Panel name genbank
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp