KIAA1336

Product ID	ORK01160
Accession No	AB037757
Description	WD repeat domain 35, transcript variant 1
Clone name	bg00080
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector(Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGC TGAAGCTTTC ACAAGTTTGT ACAAAAAAGC AGGCTCTTC-5' end of cDNA, GAGCTCTCAC CACTTTGTAC AAGAAAGCTG GGCGGCCGCT TTTTTTTTTT TTTTTTT-3' end of cDNA).
cDNA sequence	DNA sequence (6950 bp) Predicted protein sequence (1219 aa)
HaloTag ORF Clone	FHC01160
Flexi ORF Clone	FXC01160
Source	Human adult brain
Rouge ID	mKIAA1336 by Kazusa Mouse cDNA Project
Note	We replaced fh16186, former representative clones for KIAA1336 with bg00080. (2002/5/10)

Length: 6950 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3288 bp
Genome contig ID	gi89161199r_19873512
PolyA signal sequence (AATAAA,-14)	+--------+--------+----*----+---- TAAGTGAAAAAATACGAAAATAATAAACATTGAAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAATAACTTGTGTTTATTCCACGTTTTCTTTATCTATAACTTACGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	r	19973512	20053373	28	99.5	Perfect prediction

Length: 1219 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_515315	99.5	WD repeat domai...	Pan troglodytes
XP_001107482	98.1	WD repeat domai...	Macaca mulatta
Q9P2L0	100.0	WD repeat-conta...	Homo sapiens
XP_532884	94.2	similar to WD r...	Canis lupus fam...
XP_001072062	92.8	similar to WD r...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037818	5.1e-18	29.3	KIAA1397

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001680	57	80	PF00400	WD40 repeat
HMMPfam	IPR001680	99	137	PF00400	WD40 repeat
HMMSmart	IPR001680	42	80	SM00320	WD40 repeat
	IPR001680	98	137	SM00320	WD40 repeat
	IPR001680	142	181	SM00320	WD40 repeat
	IPR001680	185	222	SM00320	WD40 repeat
	IPR001680	531	568	SM00320	WD40 repeat
ProfileScan	IPR001680	105	136	PS50082	WD40 repeat
ProfileScan	IPR001680	105	190	PS50294	WD40 repeat

Primer_f	ATCTCCTGTTGAACTTGCATC
Primer_r	ATGGACTAAGAATTGCAGCTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-