KIAA1397

Product ID	ORK00825
Accession No	AB037818
Description	tubby like protein 4, transcript variant 2
Clone name	hj08255
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4810 bp) Predicted protein sequence (686 aa)
HaloTag ORF Clone	FHC00825
Flexi ORF Clone	FXC00825
Source	Human adult brain
Rouge ID	mKIAA1397 by Kazusa Mouse cDNA Project

Length: 4810 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1416 bp
Genome contig ID	gi89161210f_158553680
PolyA signal sequence (ATTAAA,-22)	+--------+--------+----*----+---- CTGAGAAAACGTTATTAAAATTGTAATACCTAGGT
Flanking genome sequence (295358 - 295407)	----+--------+--------+--------+--------+----* AGTTGGTTGATCACAGTTTGTTAATTGTATAAAAAAAAATTACCTAGAAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	6	f	158653680	158849036	13	99.4	Perfect prediction

Length: 686 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAG01020	100.0	tubby super-fam...	Homo sapiens
XP_001145255	99.9	tubby like prot...	Pan troglodytes
XP_001145331	100.0	tubby like prot...	Pan troglodytes
Q9NRJ4	100.0	Tubby-related p...	Homo sapiens
AAF87975	100.0	tubby super-fam...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037757	9e-16	29.3	KIAA1336

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001680	80	118	PF00400	WD40 repeat
HMMPfam	IPR001496	382	419	PF07525	SOCS protein
HMMSmart	IPR001680	79	118	SM00320	WD40 repeat
HMMSmart	IPR001680	167	203	SM00320	WD40 repeat
ProfileScan	IPR001680	86	117	PS50082	WD40 repeat
	IPR001680	86	212	PS50294	WD40 repeat
	IPR001496	381	422	PS50225	SOCS protein

Primer_f	CCACTAGTTTCATCGTTTGTC
Primer_r	GAGAAAACTGCTACCACTACC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CCACTAGTTTCATCGTTTGTC
Primer_r	GAGAAAACTGCTACCACTACC
PCR product length	128 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles