Order Kazusa clone(s) from : ![]() |
Product ID | ORK00806 |
---|---|
Accession No | AB037758 |
Description | patched domain containing 2 |
Clone name | fh16696 |
Vector information | |
cDNA sequence | DNA sequence (5181 bp) Predicted protein sequence (1438 aa) |
HaloTag ORF Clone |
FHC00806
![]() |
Flexi ORF Clone | FXC00806 |
Source | Human fetal brain |
Rouge ID |
mKIAA1337
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 864 bp |
---|---|
Genome contig ID | gi89161185f_11361882 |
PolyA signal sequence (ATTAAA,-21) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (158314 - 158363) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 1 | f | 11461882 | 11520194 | 21 | 99.8 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR003392 | 285 | 1392 | PF02460 | Patched |
ProfileScan | IPR000731 | 556 | 661 | PS50156 | Sterol-sensing 5TM box |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 118 | CCAGLVLFLGCSIPMALSAFMFL | 140 | PRIMARY | 23 | 2 | 506 | NNDMLLAFISSSCIAALVYILTS | 528 | PRIMARY | 23 | 3 | 536 | FGIASIGLSCLVALFLYHVVFGI | 558 | PRIMARY | 23 | 4 | 565 | NGVAAFVIVGIGVDDVFVFINTY | 587 | PRIMARY | 23 | 5 | 611 | TFFTSLTTAAAYAANVFSQIPAV | 633 | SECONDARY | 23 | 6 | 642 | LIVSCCWLAVLVTMPAALGLWSL | 664 | PRIMARY | 23 | 7 | 775 | RWVIVGLFVSILILSLVFASR | 795 | PRIMARY | 21 | 8 | 932 | ACMSTVGLLQAASPSRKWMLTTL | 954 | SECONDARY | 23 | 9 | 1047 | VRPLVDTGAMVFVVFGIIGVNR | 1068 | PRIMARY | 22 | 10 | 1220 | FMEIVGVQSALCGLVLSLLICVA | 1242 | PRIMARY | 23 | 11 | 1251 | ILLLLPVLLSILGIVCLVVTIMY | 1273 | PRIMARY | 23 | 12 | 1285 | ISLSILVGSSVDYCVHLVEGYLL | 1307 | SECONDARY | 23 | 13 | 1334 | HVGVAIVSSALTTVIATVPLFFC | 1356 | PRIMARY | 23 | 14 | 1370 | LNTGVSILYTLTVSTALLGIMAP | 1392 | SECONDARY | 23 | 15 | 1403 | LKALGAVLLAGALGLGACLVLLQ | 1425 | PRIMARY | 23 |
---|
![]() |
Primer_f | TGTGGTCTTCGGCATTATTGG |
---|---|
Primer_r | AGGTCAAAGCTGCTGTCGTAG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TGTGGTCTTCGGCATTATTGG |
Primer_r | AGGTCAAAGCTGCTGTCGTAG |
PCR product length | 99(1.0k) bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |